EMU048091
MISSION® esiRNA
targeting mouse Wnt3a
Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GGGAGAAATGCCACTGTGTTTTCCATTGGTGCTGCTACGTCAGCTGCCAGGAGTGCACACGTGTCTATGACGTGCACACCTGCAAGTAGGAGAGCTCCTAACACGGGAGCAGGGTTCATTCCGAGGGGCAAGGTTCCTACCTGGGGGCGGGGTTCCTACTTGGAGGGGTCTCTTACTTGGGGACTCGGTTCTTACTTGAGGGCGGAGATCCTACCTGTGAGGGTCTCATACCTAAGGACCCGGTTTCTGCCTTCAGCCTGGGCTCCTATTTGGGATCTGGGTTCCTTTTTAGGGGAGAAGCTCCTGTCTGGGATACGGGTTTCTGCCCGAGGGTGGGGCTCCACTTGGGGATGGAATTCCAATTTGGGCCGGAAGTCCTACCTCAATGGCTTGGACTCCTCTCTTGACCCGACAG
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... WNT3A(22416), Wnt3a(22416)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
12 - Non Combustible Liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Yan Xia Yu et al.
American journal of cancer research, 7(11), 2144-2156 (2017-12-09)
Therapeutic antibodies targeting colony stimulating factor 1 receptor (CSF-1R) to block colony stimulating factor-1/colony stimulating factor 1 receptor (CSF-1/CSF-R) signaling axis have exhibit remarkable efficacy in the treatment of malignant tumor. Yet, little is known about the effects of intrinsic
Hui Xu et al.
Oncology reports, 41(2), 1180-1188 (2018-11-16)
Fine particulate matter (PM2.5) is associated with an increased lung cancer risk. However, the effect of PM2.5 exposure on lung cancer cells is still largely unknown. The present study revealed that A549 lung cancer cells secreted exosomes containing high levels
Xianxian Jia et al.
International journal of molecular medicine, 47(1), 195-206 (2020-11-26)
Arrested alveolar development is the main pathological characteristic of neonatal bronchopulmonary dysplasia (BPD); however, a number of studies aiming to improve alveolarization have focused on alveolar epithelial cell damage and impairment. Previously, the authors reported that the Wnt signaling plays
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EMU048091-50UG | 04061828293568 |
| EMU048091-20UG | 04061831347593 |