Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
ATCAGTTCTGCCAGCTTGGTGTCATCACAAGCTAGTTCCAGCTCCTTTTTCACCAATGCCAATAGTTATTCAACAACTACTACCACCAGCAACATGGGAATTATGAACTTTACCAGCAGTGGTTCATCAGGGACTAGTTCTCAAGGCCAGACGCCCCAGAGGGTTGGTGGGCTACAAGGGTCTGATTCTCTGAACATCCAGCAGAACCAGACATCAGGAGGCTCGCTGCAAGGAAGTCAGCAGAAAGAGGGAGAGCAAAGTCAGCAGACACAGCAACAACAAATTCTTATTCAGCCTCAGCTAGTTCAAGGAGGACAAGCTCTTCAGGCCCTTCAAGCAGCACCATTGTCCGGACAGACCTTCACAACTCAAGCTATTTCCCAGGAAACCCTTCAGAACCTCC
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... SP1(20683), Sp1(20683)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Kazuo Asanoma et al.
Molecular and cellular biology, 35(24), 4096-4109 (2015-09-24)
BHLHE40 and BHLHE41 (BHLHE40/41) are basic helix-loop-helix type transcription factors that play key roles in multiple cell behaviors. BHLHE40/41 were recently shown to be involved in an epithelial-to-mesenchymal transition (EMT). However, the precise mechanism of EMT control by BHLHE40/41 remains
Sumegha Mitra et al.
PloS one, 9(6), e100169-e100169 (2014-06-19)
Growth arrest DNA damage inducible alpha (GADD45a) is a stress-induced gene we have shown to participate in the pathophysiology of ventilator-induced lung injury (VILI) via regulation of mechanical stress-induced Akt ubiquitination and phosphorylation. The regulation of GADD45a expression by mechanical
Li Yan et al.
American journal of cancer research, 5(4), 1447-1459 (2015-06-24)
Recent evidence suggests that miR-520 family has an important role in regulating tumorigenesis and development of various types of solid cancers. However, as one of the most common cancers in the world, there is little known about the underlying regulatory
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EMU061231-20UG | 04061831338706 |
| EMU061231-50UG | 04061828263608 |