Skip to Content
Merck
CN

EMU071691

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Clk1

Sign Into View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCCTTGCAAGCTTTGTCTTCAGGGTTGGAAAGATGAGACATTCAAAGAGAACTTACTGTCCTGACTGGGATGAAAGAGACTGGGATTATGGAACATGGAGAAGCAGCAGCAGTCACAAAAGAAAGAAGAGATCACATAGCAGCGCCCGTGAGCAAAAGCGCTGCAGGTACGATCACTCCAAAACGACAGACAGCTATTATCTGGAAAGCAGATCCATAAATGAGAAAGCTTATCATAGTCGACGCTATGTTGATGAATACAGGAATGACTACATGGGCTACGAGCCAGGGCATCCCTATGGAGAACCTGGAAGCAGATACCAGATGCATAGTAGCAAGTCCTCTGGTAGGAGTGGAAGAAGCAGTTACAAAAGTAAACACAGGAGTCGCCACCACACATCGCAGCACCATTCACACGGGATGAAATTGTTG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Apiruck Watthanasurorot et al.
PLoS genetics, 9(3), e1003361-e1003361 (2013-04-05)
Daily, circadian rhythms influence essentially all living organisms and affect many physiological processes from sleep and nutrition to immunity. This ability to respond to environmental daily rhythms has been conserved along evolution, and it is found among species from bacteria
Egle Jakubauskiene et al.
The Journal of biological chemistry, 290(29), 18079-18089 (2015-05-30)
The removal of introns from mRNA precursors (pre-mRNAs) is an essential step in eukaryotic gene expression. The splicing machinery heavily contributes to biological complexity and especially to the ability of cells to adapt to altered cellular conditions. Inhibitory PAS domain

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service