Skip to Content
Merck
CN

EMU090561

MISSION® esiRNA

targeting mouse Nod2

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

Product Name

MISSION® esiRNA, targeting mouse Nod2

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGTGCCATTCTGGAGGTTTGGCTTCGAGGGAACACATTCTCTTTGGAGGAAATCCAAACACTGAGCTCCAGGGACGCCAGACTCTTGTTGTGATGTCTCCGTTTGTGAGTGGACTGTAGGGGCCTGGACTCTGGAGGCTGAGTAACATCAGGCAGAATCCCTCTGCTACGCAGGGCTGGTTTGCTTTTCTGGATGCAGTATAGTCACCTTCTGTTAGCAGAGAAAGTCACCCCATTGCCGTCTGGAATTGACTTTTCCCGAGGAGTCGTGATGGTTGGTCTTGGTTGTTAACTGCACTGACTTAAGAGAGTCATGAGCCGAGAGGACCGCGTTTCTGCCTCTAAAGAGGATCACCATGCAGAATTAGTGACTGGAAGGGGAAAGGCCCTCACTGCATGTGGGTGACACAATCCTCTCTGGTTGCCCCGTGGGAGGATGATGGAGGAGGAGGAAGACAGGGTATGCTTGCATATGTGAGCATTTCTTCTGAGTGAGGACAGCTGTGGTTGCTGCCCTCATGTTTGAACAGCAGACTCCAGCGTCTTTGGCCATTCAACATGGACCCATCACCAGT

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ke Ke et al.
The Journal of endocrinology, 235(2), 85-96 (2017-08-06)
Nucleotide-binding oligomerization domain-2 (NOD2) is a pattern recognition receptor of the innate immune system. It interacts with serine-threonine kinases to induce activation of nuclear factor κB (NF-κB), which is important for receptor activator of nuclear factor kappa-B ligand (RANKL) signaling.
Michelle B Landes et al.
Journal of leukocyte biology, 97(6), 1111-1119 (2015-03-25)
M.tb, which causes TB, is a host-adapted intracellular pathogen of macrophages. Macrophage intracellular PRRs, such as NOD proteins, regulate proinflammatory cytokine production in response to various pathogenic organisms. We demonstrated previously that NOD2 plays an important role in controlling the
Sang-Im Lee et al.
Clinical oral investigations, 19(6), 1419-1428 (2014-12-04)
The expression levels of intracellular pyrin domain-containing 3 (NLRP3) and microbial pattern-recognition receptors, such as nucleotide-binding oligomerization domain 2 (NOD2), have been reported in human dental pulp cells (HDPCs) and inflamed dental pulp tissue, but the role of NLRP3 and

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service