EMU206411
MISSION® esiRNA
targeting mouse Tigd2
Select a Size
About This Item
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GGTCACTGAGCAAAAACCTTCTAGGAAAACTAGGAAAGCAGAACTGAATCCAGAGAAGCATATTAGTCATAAAGCTGCACTTGAATGGACTGAAAACTTGCTGGATTATCTAGAACAACAAGATGACATGCTACTCTCTGATAAGCTGGTATTGCGGAGGCTTCGGACCATTATAAGAAGAAAACAGAGAATACAAAATAAAAGTCATCTATAATACTCCCTTCTGTTGCTATGTATTTTCATCTTTGTGACTTCTATCTGCAGTGGAATTTATCTAAAGCCAAATAAATGTTACAGATGATTAGGATTAGATGATGTTTTGGATTACTTAAATTACACCTCTTTAATGTTGGCTCTGATTGAGCAATGACATGGAATTCATTTGTCAGTGTCTAAACTGTTTTATACTAATTAGATCATAGTATACTGGAGGCTGAGATATGTTGTGTACTGAATTTCAACATGTCTAGTGATGGGCAATGCACACTGTAGGCTCTCAATAAATCTTGCTCA
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... TIGD2(68140), Tigd2(68140)
Related Categories
General description
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
Storage Class Code
10 - Combustible liquids
Flash Point(F)
Not applicable
Flash Point(C)
Not applicable
Regulatory Information
Choose from one of the most recent versions:
Certificates of Analysis (COA)
It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.
If you need assistance, please contact Customer Support
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service