product line
MISSION®
form
solid
mature sequence
UAGCUUAUCAGACUGAUGUUGA
Sanger mature/minor accession no.
Sanger microRNA accession no.
storage temp.
−20°C
Gene Information
—
General description
The ready-to-use MISSION miRNA mimics are small, double-stranded RNA molecules designed to mimic endogenous mature miRNA molecules when introduced into cells. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation. MISSION miRNA Mimics, a member of MISSION RNAi product family, provides miRNA researchers with a range of options from individual MISSION mimics to a full library of human miRNA mimics based on latest version of miRBase (currently hosted by the University of Manchester, previously hosted by the Sanger Institute).
- Optimized and ready for transfection.
- Novel MISSION miRNA mimic design has been functionally tested for knockdown efficiency against natural miRNA targets.
- Unique MISSION miRNA mimic design significantly reduces possible sense strand off target effects.
- Available as a whole human library and individual miRNA targets.
Other Notes
miRBase V18 Mature ID update: hsa-miR-21-5p
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
11 - Combustible Solids
wgk
WGK 3
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
常规特殊物品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Related Content
Lina Cai et al.
Oncology letters, 15(4), 5213-5219 (2018-03-20)
Numerous studies have indicated that microRNAs (miRs), a group of small non-coding RNAs, are determining regulatory elements involved in the pathogenesis of various types of cancer, including cervical cancer (CC). Although miR-21-5p upregulation has been demonstrated to associate with tumorigenesis
Microvesicles Derived from Adult Human Bone Marrow and Tissue Specific Mesenchymal Stem Cells Shuttle Selected Pattern of miRNAs
Collino F., Deregibus M.C., Bruno S., Sterpone L., Aghemo G., et al.
PLoS ONE, 5 (2010)
C Probert et al.
Oncogene, 38(10), 1751-1763 (2018-10-26)
The role of extracellular vesicles (EVs) as vehicles for cell-to-cell communication between a tumour and its environment is a relatively new concept. The hypothesis that EVs may be critical in co-opting tissues by tumours to generate distant metastatic niches is
Global Trade Item Number
| SKU | GTIN |
|---|---|
| HMI0371-5NMOL | 04061831382228 |