Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CCTCTGATGGAAATGCCACTTCCCTGGCTGAGACCATAGACAACTGTGACTCCAGCCTCAGCAGGACATATGCCATCTCATCCTCTGTAATAAGCTTTTACATCCCTGTGGCCATCATGATTGTCACCTACACCAGGATCTACAGGATTGCTCAGAAACAAATACGGCGCATTGCGGCCTTGGAGAGGGCAGCAGTCCACGCCAAGAATTGCCAGACCACCACAGGTAATGGAAAGCCTGTCGAATGTTCTCAACCGGAAAGTTCTTTTAAGATGTCCTTCAAAAGAGAAACTAAAGTCCTGAAGACTCTGTCGGTGATCATGGGTGTGTTTGTGTGCTGTTGGCTACCTTTCTTCATCTTGAACTGCATTTTGCCCTTCTGTGGGTCTGGGGAGACGCAGCCCTTCTGCATTGATTCCAACACCTTTGACGTGTTTGTGTGG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... DRD1(1812)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Related Content
Instructions
Shengzhi Liu et al.
Cancer research, 78(14), 3865-3876 (2018-05-18)
While bone is a frequent target of breast cancer-associated metastasis, little is known about the effects of tumor-bone interactions on the efficacy of tumor-suppressing agents. Here we examined the effect of two FDA-approved dopamine modulators, fluphenazine and trifluoperazine, on mammary
Kazumasa Minami et al.
Scientific reports, 7, 45686-45686 (2017-04-05)
Dopaminergic signaling plays a critical role in the nervous system, but little is known about its potential role in breast cancer and bone metabolism. A screening of ~1,000 biologically active compounds revealed that a selective agonist of dopamine receptor D1
Fengmin Li et al.
Endocrinology, 156(6), 2211-2221 (2015-04-01)
Sorting nexin 5 (SNX5) belongs to the SNX family, which is composed of a diverse group of proteins that mediate trafficking of plasma membrane proteins, receptors, and transporters. SNX5 is important in the resensitization of the dopamine D1-like receptor (D1R).
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU000091-50UG | 04061828431236 |
| EHU000091-20UG | 04061828656509 |