Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CGGGCTCAACATCACTACCTGTCATGATGTGCTCAATGAAACCCTGCTCGAAGGCTACTATGCCTACTACTTCTCAGCCTTCTCTGCTGTCTTCTTTTTTGTGCCGCTGATCATTTCCACGGTCTGTTATGTGTCTATCATTCGATGTCTTAGCTCTTCCGCAGTTGCCAACCGCAGCAAGAAGTCCCGGGCTTTGTTCCTGTCAGCTGCTGTTTTCTGCATCTTCATCATTTGCTTCGGACCCACAAACGTCCTCCTGATTGCGCATTACTCATTCCTTTCTCACACTTCCACCACAGAGGCTGCCTACTTTGCCTACCTCCTCTGTGTCTGTGTCAGCAGCATAAGCTGCTGCATCGACCCCCTAATTTACTATTACGCTTCCTCTGAGTGCCAGAGGTACGTCTACAGTATCTTATGCTGCAAAGAAAGTTCCGATCCCA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... F2R(2149)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Related Content
Instructions
Zhuang-Zhuang Tang et al.
Phytomedicine : international journal of phytotherapy and phytopharmacology, 78, 153314-153314 (2020-09-04)
Sarsasapogenin (Sar) shows good effects on diabetic nephropathy (DN) through inhibition of the NLRP3 inflammasome, yet the potential mechanism is not well known. This study was designed to explore the regulation of thrombin and/or its receptor protease-activated receptor 1 (PAR-1)
Omozuanvbo Aisiku et al.
Blood, 125(12), 1976-1985 (2015-01-15)
Protease-activated receptor-1 (PAR1) couples the coagulation cascade to platelet activation during myocardial infarction and to endothelial inflammation during sepsis. This receptor demonstrates marked signaling bias. Its activation by thrombin stimulates prothrombotic and proinflammatory signaling, whereas its activation by activated protein
Clément d'Audigier et al.
Angiogenesis, 18(3), 347-359 (2015-06-01)
Endothelial colony forming cells (ECFC) represent a subpopulation of endothelial progenitor cells involved in endothelial repair. The activation of procoagulant mechanisms associated with the vascular wall's inflammatory responses to injury plays a crucial role in the induction and progression of
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU000271-50UG | 04061831370157 |
| EHU000271-20UG | 04061831359947 |