Skip to Content
Merck
CN

EHU001041

MISSION® esiRNA

targeting human SETD7

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GATGGGGAGATGACTGGAGAGAAGATAGCCTATGTGTACCCTGATGAGAGGACCGCACTTTATGGGAAATTTATTGATGGAGAGATGATAGAAGGCAAACTGGCTACCCTTATGTCCACTGAAGAAGGGAGGCCTCACTTTGAACTGATGCCTGGAAATTCAGTGTACCACTTTGATAAGTCGACTTCATCTTGCATTTCTACCAATGCTCTTCTTCCAGATCCTTATGAATCAGAAAGGGTTTATGTTGCTGAATCTCTTATTTCCAGTGCTGGAGAAGGACTTTTTTCAAAGGTAGCTGTGGGACCTAATACTGTTATGTCTTTTTATAATGGAGTTCGAATTACACACCAAGAGGTTGACAGCAGGGACTGGGCCCTTAATGGGAACACCCTCTCCCTTGATGAAGAAACGGTCATTGATGTGCCTGAGCCCTATAACC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Chun-Mei Wang et al.
International journal of immunopathology and pharmacology, 30(3), 264-271 (2017-08-02)
Our previous high-throughput sequencing indicated that rno-miR-1298 was down-regulated in ischemia-reperfusion model of rat. However, little is known about the function and molecular mechanism of rno-miR-1298 in rat tumor cell. In this study, rno-miR-1298 was detected to be significantly down-regulated
Shi-Lan Zhang et al.
American journal of translational research, 12(2), 602-611 (2020-03-21)
SET7 is the first lysine methyltransferase and plays vital roles in tumorigenesis. This study aims to seek clinical value of SET7 in colorectal cancer (CRC) patients, along with its biological impact on cell proliferation and migration. In patients with CRC
Yong-Sun Maeng et al.
BMC medical genomics, 8, 74-74 (2015-11-11)
TGFβ1-induced expression of transforming growth factor β-induced protein (TGFBIp) and extracellular matrix (ECM) genes plays a major role in the development of granular corneal dystrophy type 2 (GCD2: also called Avellino corneal dystrophy). Although some key transcription factors are known

Related Content

Instructions

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service