Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GCTCTTACTGCCAGGGACTGATGATGGTTAAACCCTGTGGCGGTTACTGCAATGTGGTCATGCAAGGCTGTATGGCAGGTGTGGTGGAGATTGACAAGTACTGGAGAGAATACATTCTGTCCCTTGAAGAACTTGTGAATGGCATGTACAGAATCTATGACATGGAGAACGTACTGCTTGGTCTCTTTTCAACAATCCATGATTCTATCCAGTATGTCCAGAAGAATGCAGGAAAGCTGACCACCACTATTGGCAAGTTATGTGCCCATTCTCAACAACGCCAATATAGATCTGCTTATTATCCTGAAGATCTCTTTATTGACAAGAAAGTATTAAAAGTTGCTCATGTAGAACATGAAGAAACCTTATCCAGCCGAAGAAGGGAACTAATTCAGAAGTTGAAGTCTTTCATCAGCTTCTATAGTGCTTTGCCTGGCTACAT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... GPC3(2719)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Related Content
Instructions
Xiubin Fei et al.
Oncology letters, 15(6), 9081-9086 (2018-05-29)
Lung cancer is a major cause of death worldwide, and non-small cell lung cancer (NSCLC) is the most common type of lung cancer. The aim of this study was to investigate whether miR-96 mediated the invasion and metastasis of NSCLC
Autophagy suppresses proliferation of HepG2 cells via inhibiting glypican-3/wnt/β-catenin signaling.
Pei Hu et al.
OncoTargets and therapy, 11, 193-200 (2018-01-31)
Autophagy plays an important role in the growth and survival of hepatocellular carcinoma (HCC) cells through several target proteins or signaling pathways. Glypican-3 (GPC3) is a new reliable HCC marker, which is involved in tumor growth in HCC, primarily mediated
Weitong Sun et al.
Biomaterials science, 5(12), 2468-2479 (2017-11-07)
Hepatocellular carcinoma (HCC) is one of the most common malignancies imposing a serious threat to human health worldwide. To date, the effect of HCC chemotherapy has been limited due to drug resistance. Combination therapy of chemotherapeutic drugs and siRNA represents
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU001531-50UG | 04061828442430 |
| EHU001531-20UG | 04061831360073 |