Skip to Content
Merck
CN

EHU001531

Sigma-Aldrich

MISSION® esiRNA

targeting human GPC3

Sign Into View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCTCTTACTGCCAGGGACTGATGATGGTTAAACCCTGTGGCGGTTACTGCAATGTGGTCATGCAAGGCTGTATGGCAGGTGTGGTGGAGATTGACAAGTACTGGAGAGAATACATTCTGTCCCTTGAAGAACTTGTGAATGGCATGTACAGAATCTATGACATGGAGAACGTACTGCTTGGTCTCTTTTCAACAATCCATGATTCTATCCAGTATGTCCAGAAGAATGCAGGAAAGCTGACCACCACTATTGGCAAGTTATGTGCCCATTCTCAACAACGCCAATATAGATCTGCTTATTATCCTGAAGATCTCTTTATTGACAAGAAAGTATTAAAAGTTGCTCATGTAGAACATGAAGAAACCTTATCCAGCCGAAGAAGGGAACTAATTCAGAAGTTGAAGTCTTTCATCAGCTTCTATAGTGCTTTGCCTGGCTACAT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Xiubin Fei et al.
Oncology letters, 15(6), 9081-9086 (2018-05-29)
Lung cancer is a major cause of death worldwide, and non-small cell lung cancer (NSCLC) is the most common type of lung cancer. The aim of this study was to investigate whether miR-96 mediated the invasion and metastasis of NSCLC
Pei Hu et al.
OncoTargets and therapy, 11, 193-200 (2018-01-31)
Autophagy plays an important role in the growth and survival of hepatocellular carcinoma (HCC) cells through several target proteins or signaling pathways. Glypican-3 (GPC3) is a new reliable HCC marker, which is involved in tumor growth in HCC, primarily mediated
Weitong Sun et al.
Biomaterials science, 5(12), 2468-2479 (2017-11-07)
Hepatocellular carcinoma (HCC) is one of the most common malignancies imposing a serious threat to human health worldwide. To date, the effect of HCC chemotherapy has been limited due to drug resistance. Combination therapy of chemotherapeutic drugs and siRNA represents

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service