Skip to Content
Merck
CN

EHU001851

Sigma-Aldrich

MISSION® esiRNA

targeting human UBE2O

Sign Into View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGGACAACAACGAGTTCTGCCCTGGAGACTTCGTGGTAGATAAGCGAGTCCAGAGCTGTCCAGACCCTGCTGTCTACGGTGTGGTACAGTCTGGGGACCACATCGGCCGTACCTGCATGGTGAAGTGGTTCAAGCTGAGGCCGAGTGGGGACGACGTGGAGCTGATTGGAGAAGAGGAAGATGTGAGTGTTTACGACATTGCTGACCACCCTGACTTTAGGTTCCGTACAACTGACATCGTCATCCGCATCGGCAATACTGAGGATGGGGCTCCTCACAAGGAGGATGAGCCATCGGTGGGCCAGGTGGCCCGTGTGGACGTCAGCAGCAAGGTGGAGGTGGTGTGGGCTGACAACTCAAAGACCATCATCCTGCCCCAGCACTTGTACAACATAGAGTCTGAGATTGAGGAGTCAGACTACGATTCGGTAGAAGGCAGCAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Bobin Mi et al.
Journal of nanobiotechnology, 18(1), 68-68 (2020-05-08)
Enhancing angiogenesis is critical for accelerating wound healing. Application of different types of exosomes (Exos) to promote angiogenesis represents a novel strategy for enhanced wound repair. Saliva is known to accelerate wound healing, but the underlying mechanisms remain unclear. Our
Salima Daou et al.
Nature communications, 9(1), 4385-4385 (2018-10-24)
The tumor suppressor and deubiquitinase (DUB) BAP1 and its Drosophila ortholog Calypso assemble DUB complexes with the transcription regulators Additional sex combs-like (ASXL1, ASXL2, ASXL3) and Asx respectively. ASXLs and Asx use their DEUBiquitinase ADaptor (DEUBAD) domain to stimulate BAP1/Calypso

Related Content

Instructions

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service