Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
ATTCCACTGCAGGCTGATTTCATCGGGGTTGTCCGAAACAATGAAGCCTTAGCAAGACTTTCCTGTGCATTTAAGACAGAAAACCAAACTCGCCAGGTGGTATGTGACCTTGGAAACCCAATGAAGGCTGGAACTCAACTCTTAGCTGGTCTTCGTTTCAGTGTGCACCAGCAGTCAGAGATGGATACTTCTGTGAAATTTGACTTACAAATCCAAAGCTCAAATCTATTTGACAAAGTAAGCCCAGTTGTATCTCACAAAGTTGATCTTGCTGTTTTAGCTGCAGTTGAGATAAGAGGAGTCTCGAGTCCTGATCATGTCTTTCTTCCGATTCCAAACTGGGAGCACAAGGAGAACCCTGAGACTGAAGAAGATGTTGGGCCAGTTGTTCAGCACATCTATGAGCTGAGAAACAATGGTCCAAGTTCATTCAGCAAGGCA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... ITGAV(3685)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Related Content
Instructions
Chuyue Zhang et al.
ACS nano, 14(9), 12133-12147 (2020-08-14)
Extracellular vesicles (EVs) derived from mesenchymal stem cells (MSC-EVs) have been recognized as a promising cell-free therapy for acute kidney injury (AKI), which avoids safety concerns associated with direct cell engraftment. However, low stability and retention of MSC-EVs have limited
Weikun Xiao et al.
Matrix biology : journal of the International Society for Matrix Biology, 85-86, 128-146 (2019-04-28)
Originating in the brain, glioblastoma (GBM) is a highly lethal and virtually incurable cancer, in large part because it readily develops resistance to treatments. While numerous studies have investigated mechanisms enabling GBM cells to evade chemotherapy-induced apoptosis, few have addressed
Bin Zhang et al.
Cancer letters, 459, 204-215 (2019-06-15)
Macrophage-targeted therapy offers new options for intractable pancreatic ductal adenocarcinoma (PDAC), which has a low 5-year survival rate. However, the factors regulating the biological function and phenotype of macrophages in PDAC are incompletely understood. Here, we found that CD51 was
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU002301-50UG | 04061828443154 |
| EHU002301-20UG | 04061828657216 |