Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CTCAGAACCCCAGGCAGTAGACTTCCTAGAATGTGCAGAAGAAGCTAGAAAAAAGATTAATTCCTGGGTCAAGACTCAAACCAAAGGCAAAATCCCAAACTTGTTACCTGAAGGTTCTGTAGATGGGGATACCAGGATGGTCCTGGTGAATGCTGTCTACTTCAAAGGAAAGTGGAAAACTCCATTTGAGAAGAAACTAAATGGGCTTTATCCTTTCCGTGTAAACTCGGCTCAGCGCACACCTGTACAGATGATGTACTTGCGTGAAAAGCTAAACATTGGATACATAGAAGACCTAAAGGCTCAGATTCTAGAACTCCCATATGCTGGAGATGTTAGCATGTTCTTGTTGCTTCCAGATGAAATTGCCGATGTGTCCACTGGCTTGGAGCTGCTGGAAAGTGAAATAACCTATGACAAACTCAACAAGTGGACCAGCAA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... SERPINB2(5055)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Related Content
Instructions
Eleonora Longhin et al.
Archives of toxicology (2018-07-11)
Exposure to particulate matter (PM) has been related to the onset of adverse health effects including lung cancer, but the underlying molecular mechanisms are still under investigation. Epithelial-to-mesenchymal transition (EMT) is regarded as a crucial step in cancer progression. In
Ziqi Meng et al.
International immunopharmacology, 81, 106028-106028 (2019-12-06)
To investigate the effect of miR-200c/PAI-2 on macrophage polarization into M2-type TAMs in TNBC. PAI-2 expression in MDA-MB-231con, MDA-MB-231miR-200ab and MDA-MB-231miR-200c breast cancer cells was evaluated by RT-PCR and immunofluorescence (IF), while the expression of the TAM marker F4/80 and
Tiefeng Jin et al.
Oncotarget, 8(20), 32769-32782 (2017-04-22)
The microRNA-200 (miR-200) family is associated with tumor metastasis and poor patient prognosis. We found that miR-200c/141 cluster overexpression upregulated SerpinB2 in the MDA-MB-231 triple-negative (TN) breast cancer cell line. We observed transcription factor (c-Jun, c-Fos, and FosB) upregulation, nuclear
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU002791-50UG | 04061828443598 |
| EHU002791-20UG | 04061831360257 |