Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
ACGGGTACCTCTCCCACACCGAGCTGGCTCCACTGCGTGCTCCCCTCATCCCCATGGAGCATTGCACCACCCGCTTTTTCGAGACCTGTGACCTGGACAATGACAAGTACATCGCCCTGGATGAGTGGGCCGGCTGCTTCGGCATCAAGCAGAAGGATATCGACAAGGATCTTGTGATCTAAATCCACTCCTTCCACAGTACCGGATTCTCTCTTTAACCCTCCCCTTCGTGTTTCCCCCAATGTTTAAAATGTTTGGATGGTTTGTTGTTCTGCCTGGAGACAAGGTGCTAACATAGATTTAAGTGAATACATTAACGGTGCTAAAAATGAAAATTCTAACCCAAGACATGACATTCTTAGCTGTAACTTAACTATTAAGGCCTTTTCCACACGCATTAATAGTCCCATTTTTCTCTTGCCATTTGTAGCTTTGCCCAT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... SPARC(6678)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Related Content
Instructions
Jijun Fu et al.
Carcinogenesis, 38(6), 649-660 (2017-05-13)
Oncogene c-Myc is frequently amplified and activated in human cancers. Deregulation of c-Myc protein has been shown to occur in 30% of all human cancers, especially in hematopoietic malignancies. As a transcription factor, c-Myc has been shown to regulate up
Jing Zhu et al.
Stem cells (Dayton, Ohio), 38(1), 134-145 (2019-10-24)
The purpose of this study was to investigate the effects of secreted protein acidic and rich in cysteine (SPARC) on the maintenance of limbal epithelial stem cell (LESC) stemness and restoration of ocular surface. To determine the suitable concentration of
Katrina Viloria et al.
Scientific reports, 6, 37839-37839 (2016-11-26)
SPARC is a matricellular protein that is involved in both pancreatic cancer and diabetes. It belongs to a wider family of proteins that share structural and functional similarities. Relatively little is known about this extended family, but evidence of regulatory
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU002941-20UG | 04061831360301 |
| EHU002941-50UG | 04061828443741 |