Skip to Content
Merck
CN

EHU003671

MISSION® esiRNA

targeting human FUT4

Sign In to View Organizational & Contract Pricing.

Select a Size

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324

Key Documents

View All Documentation
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

Product Name

MISSION® esiRNA, targeting human FUT4

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGTACCTGCTTTTCCTCGACCGCAACCCCGCGGTCTATCGCCGCTACTTCCACTGGCGCCGGAGCTACGCTGTCCACATCACCTCCTTCTGGGACGAGCCTTGGTGCCGGGTGTGCCAGGCTGTACAGAGGGCTGGGGACCGGCCCAAGAGCATACGGAACTTGGCCAGCTGGTTCGAGCGGTGAAGCCGCGCTCCCCTGGAAGCGACCCAGGGGAGGCCAAGTTGTCAGCTTTTTGATCCTCTACTGTGCATCTCCTTGACTGCCGCATCATGGGAGTAAGTTCTTCAAACACCCATTTTTGCTCTATGGGAAAAAAACGATTTACCAATTAATATTACTCAGCACAGAGATGGGGGCCCGGTTTCCATATTTTTTGCACAGCTAGCAATTGGGCTCCCTTTGCTGCTGATGGGCATCATTGTTTAGGGGTGAAGGAGG

Ensembl | human accession no.

ENSG00000196371

NCBI accession no.

NM_002033

shipped in

ambient

storage temp.

−20°C

Quality Level

100

Gene Information

human ... FUT4(2526), FUT4(2526)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Qin Zheng et al.
Cell death and differentiation, 24(12), 2161-2172 (2017-09-16)
Successful embryo implantation requires the establishment of a receptive endometrium. Poor endometrial receptivity has generally been considered as a major cause of infertility. Protein glycosylation is associated with many physiological and pathological processes. The fucosylation is catalyzed by the specific
X Yang et al.
Cell death & disease, 4, e735-e735 (2013-07-28)
Epithelial-mesenchymal transition (EMT) is a crucial step in tumor progression and has an important role during cancer invasion and metastasis. Although fucosyltransferase IV (FUT4) has been implicated in the modulation of cell migration, invasion and cancer metastasis, its role during
Xiu Shan et al.
IUBMB life, 72(5), 942-956 (2020-01-22)
Malignant melanoma is one of the most aggressive human tumor types, mainly due to its high invasion capability, metastatic properties, and the absence of effective treatments. Glycosylation serves a pivotal role in the migration and invasion of melanoma. However, differences
Yang Li et al.
Cell death & disease, 8(6), e2892-e2892 (2017-06-24)
Metastasis is a multistep molecular network process, which is the major cause of death in patients with colorectal cancer (CRC). MicroRNAs (miRNAs) play pivotal roles in tumorigenesis as either tumor suppressors or oncogenes. Increased expression of fucosyltransferase4 (FUT4) has been
Ming Yu et al.
Scientific reports, 7(1), 5315-5315 (2017-07-15)
Glycosylation of uterine endometrial cells plays important roles to determine their receptive function to blastocysts. Trophoblast-derived pregnancy-associated plasma protein A (PAPPA) is specifically elevated in pregnant women serum, and is known to promote trophoblast cell proliferation and adhesion. However, the
View All Related Papers

Related Content

MISSION esiRNA

Instructions

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service