Skip to Content
Merck
CN

EHU003961

MISSION® esiRNA

targeting human USP13

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGATCGCCTGATGAACCAATTGATAGACCCATCAGACATCGATGAGTCATCAGTGATGCAGCTGGCCGAGATGGGTTTCCCGCTGGAAGCATGTCGCAAGGCTGTGTACTTCACTGGAAATATGGGCGCCGAGGTGGCCTTCAACTGGATCATTGTTCACATGGAAGAGCCAGATTTTGCTGAGCCGCTGACCATGCCTGGTTATGGAGGGGCAGCTTCTGCTGGAGCCTCTGTTTTTGGTGCTTCTGGACTGGATAACCAACCTCCAGAGGAAATCGTAGCTATCATCACCTCCATGGGATTTCAGCGAAATCAGGCTATTCAGGCACTACGAGCAACGAATAATAACCTGGAAAGAGCACTGGATTGGATCTTTAGCCACCCTGAGTTTGAAGAAGACAGTGATTTTGTGATTGAGATGGAGAATAATGCCAATGCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

12 - Non Combustible Liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yue Wu et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 114, 108831-108831 (2019-04-16)
USP13 is emerging as a potential target in cancer therapy. However, the effect of USP13 on tumor progression is controversial. Here we focused on non-small cell lung cancer (NSCLC), a common cancer with high mortality, and studied the role of
Yuning Liao et al.
Journal of experimental & clinical cancer research : CR, 38(1), 157-157 (2019-04-13)
Prostate cancer (PCa) remains a challenge worldwide. Due to the development of castration-resistance, traditional first-line androgen deprivation therapy (ADT) became powerlessness. Epidermal growth factor receptor (EGFR) is a well characterized therapeutic target to treat colorectal carcinoma and non-small cell lung
Xiaoguang Fang et al.
The Journal of experimental medicine, 214(1), 245-267 (2016-12-08)
Glioblastoma is the most lethal brain tumor and harbors glioma stem cells (GSCs) with potent tumorigenic capacity. The function of GSCs in tumor propagation is maintained by several core transcriptional regulators including c-Myc. c-Myc protein is tightly regulated by posttranslational
Shan Gao et al.
Frontiers in cell and developmental biology, 8, 587389-587389 (2020-11-17)
Hepatocellular carcinoma (HCC) is one of the leading causes of cancer death worldwide. The activation of the toll-like receptor 4/myeloid differentiation primary response gene 88/nuclear factor-κB (TLR4/MyD88/NF-κB) pathway contributes to the development and progression of HCC. The ubiquitin-proteasome system regulates

Related Content

Instructions

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service