Skip to Content
Merck
CN

EHU004281

MISSION® esiRNA

targeting human IDH2

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

Product Name

MISSION® esiRNA, targeting human IDH2

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGCCCATCATCTGCAAAAACATCCCACGCCTAGTCCCTGGCTGGACCAAGCCCATCACCATTGGCAGGCACGCCCATGGCGACCAGTACAAGGCCACAGACTTTGTGGCAGACCGGGCCGGCACTTTCAAAATGGTCTTCACCCCAAAAGATGGCAGTGGTGTCAAGGAGTGGGAAGTGTACAACTTCCCCGCAGGCGGCGTGGGCATGGGCATGTACAACACCGACGAGTCCATCTCAGGTTTTGCGCACAGCTGCTTCCAGTATGCCATCCAGAAGAAATGGCCGCTGTACATGAGCACCAAGAACACCATACTGAAAGCCTACGATGGGCGTTTCAAGGACATCTTCCAGGAGATCTTTGACAAGCACTATAAGACCGACTTCGACAAGAATAAGATCTGGTATGAGCACCGGCTCATTGATGACATGGTGGCTCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Bonnie H Y Yeung et al.
American journal of respiratory cell and molecular biology, 63(1), 36-45 (2020-03-10)
Global DNA hydroxymethylation mediated by the TET (ten-eleven translocation) enzyme was induced in allergen-induced airway hyperresponsiveness in mouse lung tissues and specifically in isolated airway smooth muscle (ASM) cells. TET is an α-ketoglutarate (α-KG)-dependent enzyme, and the production of α-KG
Su-Jeong Choi et al.
Biochemical and biophysical research communications, 503(3), 1805-1811 (2018-08-04)
Isocitrate dehydrogenase 2 (IDH2) is an essential enzyme in the mitochondrial antioxidant system, which produces nicotinamide adenine dinucleotide phosphate, and thereby defends against oxidative stress. We have shown that IDH2 downregulation results in mitochondrial dysfunction and reactive oxygen species (ROS)
Fen Gong et al.
Biochemical and biophysical research communications, 514(3), 593-600 (2019-05-09)
Nonalcoholic fatty liver disease (NAFLD) has become an epidemic across the world. A large and growing unmet therapeutic requirement has inspired plenty exploration in the field. Isocitrate dehydrogenase 2 (IDH2), localized in mitochondria, decreases NADP+ to NADPH during the decarboxylation

Related Content

Instructions

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service