Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AGCCCATCATCTGCAAAAACATCCCACGCCTAGTCCCTGGCTGGACCAAGCCCATCACCATTGGCAGGCACGCCCATGGCGACCAGTACAAGGCCACAGACTTTGTGGCAGACCGGGCCGGCACTTTCAAAATGGTCTTCACCCCAAAAGATGGCAGTGGTGTCAAGGAGTGGGAAGTGTACAACTTCCCCGCAGGCGGCGTGGGCATGGGCATGTACAACACCGACGAGTCCATCTCAGGTTTTGCGCACAGCTGCTTCCAGTATGCCATCCAGAAGAAATGGCCGCTGTACATGAGCACCAAGAACACCATACTGAAAGCCTACGATGGGCGTTTCAAGGACATCTTCCAGGAGATCTTTGACAAGCACTATAAGACCGACTTCGACAAGAATAAGATCTGGTATGAGCACCGGCTCATTGATGACATGGTGGCTCA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... IDH2(3418)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Related Content
Instructions
Su-Jeong Choi et al.
Biochemical and biophysical research communications, 503(3), 1805-1811 (2018-08-04)
Isocitrate dehydrogenase 2 (IDH2) is an essential enzyme in the mitochondrial antioxidant system, which produces nicotinamide adenine dinucleotide phosphate, and thereby defends against oxidative stress. We have shown that IDH2 downregulation results in mitochondrial dysfunction and reactive oxygen species (ROS)
Fen Gong et al.
Biochemical and biophysical research communications, 514(3), 593-600 (2019-05-09)
Nonalcoholic fatty liver disease (NAFLD) has become an epidemic across the world. A large and growing unmet therapeutic requirement has inspired plenty exploration in the field. Isocitrate dehydrogenase 2 (IDH2), localized in mitochondria, decreases NADP+ to NADPH during the decarboxylation
Bonnie H Y Yeung et al.
American journal of respiratory cell and molecular biology, 63(1), 36-45 (2020-03-10)
Global DNA hydroxymethylation mediated by the TET (ten-eleven translocation) enzyme was induced in allergen-induced airway hyperresponsiveness in mouse lung tissues and specifically in isolated airway smooth muscle (ASM) cells. TET is an α-ketoglutarate (α-KG)-dependent enzyme, and the production of α-KG
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU004281-50UG | 04061828452644 |
| EHU004281-20UG | 04061831360554 |