Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TGGGTCCTGAGGATGAAGACTCCTTCTCCAACGCTGAGTCTTATGAGAACGAGGATGAAGAGCTGACCCAGCCGGTCGCCAGGACAATGGACTTCCTGAGCCCTCATGGGTCAGCCTGGGACCCCAGCCGGGAAGCAACCTCCCTGGGGTCCCAGTCCTATGAGGATATGAGAGGAATCCTGTATGCAGCCCCCCAGCTCCGCTCCATTCGGGGCCAGCCTGGACCCAATCATGAGGAAGATGCAGACTCTTATGAGAACATGGATAATCCCGATGGGCCAGACCCAGCCTGGGGAGGAGGGGGCCGCATGGGCACCTGGAGCACCAGGTGATCCTCAGGTGGCCAGCCTGGATCTCCTCAAGTCCCCAAGATTCACACCTGACTCTGAAATCTGAAGACCTCGAGCAGATGATGCCAACCTCTGGAGCAATGTT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... CD19(930)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Related Content
Instructions
Sheng-Dan Nie et al.
Neurobiology of aging, 67, 171-180 (2018-04-21)
High glucose (HG)-induced mammalian target of rapamycin (mTOR) overactivation acts as a signaling hub for the formation of tau hyperphosphorylation, which contributes to the development of diabetes-associated cognitive deficit. How HG induces the sustained activation of mTOR in neurons is
Feng Yan et al.
Experimental neurology, 297, 92-100 (2017-08-02)
Neuronal apoptosis is a central pathological process in subarachnoid hemorrhage (SAH)-induced early brain injury. Previous studies indicated that ErbB4 (EGFR family member v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4) is essential for normal development and maintenance of the nervous
Areumnuri Kim et al.
Oncotarget, 6(35), 38225-38238 (2015-10-31)
Although proteasome inhibition with bortezomib (BTZ) is a validated treatment for relapsed or refractory mantle cell lymphoma (MCL), many patients show resistance to BTZ. However, the molecular mechanism of BTZ resistance in MCL has not been elucidated. In the present
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU007101-20UG | 04061828677900 |
| EHU007101-50UG | 04061828453818 |