Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
ATCTTGAAAACGGAGCTGGATGAGTGGGCTGCGGCCATGAATGCCGAGTTTGAAGCTGCTGAGCAGTTTGATCTCCTGGTTGAATGAGATGCAGTGGGGGGTGCACCTGGCCAGACTCTCCCTCCTGTCCTGTACATAGCCACCTCCCTGTGGAGAGGACACTTAGGGTCCCCTCCCCTGGTCTTGTTACCTGTGTGTGTGCTGGTGCTGCGCATGAGGACTGTCTGCCTTTGAGGGCTTGGGCAGCAGCGGCAGCCATCTTGGTTTTAGGAAATGGGGCCGCCTGGCCCAGCCACTCACTGGTGTCCTGTCTCTTGTCGTCCTGTCCTTCCTATCTCCCCAAAGTACCATAGCCAGTTTCCAGATGGGCCACAGACTGGGGAGGAGAATCAGTGGCCCAGCCAGAAGTTAAAGGGCTGAGGGTTGAGGTGAGAG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... CDCA5(113130)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Related Content
Instructions
Jianlin Wang et al.
Oncology reports, 40(4), 1875-1884 (2018-07-18)
Cell division cycle associated 5 (CDCA5) has been associated with the progression of several types of cancers. However, its possible role and mechanism in hepatocellular carcinoma (HCC) remain unknown. In the present study, immunohistochemical staining and real‑time PCR were used to
Tatsuya Kato et al.
International journal of oncology, 49(6), 2411-2420 (2016-11-15)
Malignant pleural mesothelioma (MPM) is an aggressive type of cancer of the thoracic cavity commonly associated with asbestos exposure and a high mortality rate. There is a need for new molecular targets for the development of more effective therapies for
Chun-Jie Huang et al.
In vitro cellular & developmental biology. Animal, 53(3), 258-264 (2016-11-09)
Maintenance and timely termination of cohesion on chromosomes ensures accurate chromosome segregation to guard against aneuploidy in mammalian oocytes and subsequent chromosomally abnormal pregnancies. Sororin, a cohesion stabilizer whose relevance in antagonizing the anti-cohesive property of Wings-apart like protein (Wapl)
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU007531-20UG | 04061828678280 |
| EHU007531-50UG | 04061828454228 |