Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CAATTCCAGGGGAAGTGGTATGTGGTAGGCCTGGCAGGGAATGCAATTCTCAGAGAAGACAAAGACCCGCAAAAGATGTATGCCACCATCTATGAGCTGAAAGAAGACAAGAGCTACAATGTCACCTCCGTCCTGTTTAGGAAAAAGAAGTGTGACTACTGGATCAGGACTTTTGTTCCAGGTTGCCAGCCCGGCGAGTTCACGCTGGGCAACATTAAGAGTTACCCTGGATTAACGAGTTACCTCGTCCGAGTGGTGAGCACCAACTACAACCAGCATGCTATGGTGTTCTTCAAGAAAGTTTCTCAAAACAGGGAGTACTTCAAGATCACCCTCTACGGGAGAACCAAGGAGCTGACTTCGGAACTAAAGGAGAACTTCATCCGCTTCTCCAAATCTCTGGGCCTCCCTGAAAACCACATCGTCTTCCCTGTC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... LCN2(3934)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Related Content
Instructions
Se-Lim Kim et al.
Cancer science, 108(11), 2176-2186 (2017-09-01)
Lipocalin 2 (LCN2), a member of the lipocalin superfamily, plays an important role in oncogenesis and progression in various types of cancer. However, the expression pattern and functional role of LCN2 in colorectal cancer (CRC) is still poorly understood. The
Masafumi Okuda et al.
Oncotarget, 8(21), 34670-34677 (2017-04-15)
Esophageal cancer is the eighth most common cancer and the sixth most common cause of cancer-related deaths worldwide. Despite the research progress in understanding the disease, the mechanism underlying the metastasis is still unclear. Here, we successfully generated a highly
Ioanna Mosialou et al.
The Journal of experimental medicine, 217(10) (2020-07-09)
Regulation of food intake is a recently identified endocrine function of bone that is mediated by Lipocalin-2 (LCN2). Osteoblast-secreted LCN2 suppresses appetite and decreases fat mass while improving glucose metabolism. We now show that serum LCN2 levels correlate with insulin
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU007551-20UG | 04061828670932 |
| EHU007551-50UG | 04061828454242 |