Skip to Content
Merck
CN

EHU007651

MISSION® esiRNA

targeting human PDK4

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGAGACTCGCCAACATTCTGAAGGAAATTGATATCCTCCCGACCCAATTAGTAAATACCTCTTCAGTGCAATTGGTTAAAAGCTGGTATATACAGAGCCTGATGGATTTGGTGGAATTCCATGAGAAAAGCCCAGATGACCAGAAAGCATTATCAGACTTTGTAGATACACTCATCAAAGTTCGAAATAGACACCATAATGTAGTCCCTACAATGGCACAAGGAATCATAGAGTATAAAGATGCCTGTACAGTTGACCCAGTCACCAATCAAAATCTTCAATATTTCTTGGATCGATTTTACATGAACCGTATTTCTACTCGGATGCTGATGAACCAGCACATTCTTATATTTAGTGACTCACAGACAGGAAACCCAAGCCACATTGGAAGCATTGATCCTAACTGTGATGTGGTAGCAGTGGTCCAAGATGCCTTTGAGTGTTCAAGGATGCTCTGTGATCAGTATTATTTATCATCTCCAGAATTAAAGCTTACACAAGTGAATGGAAAATTTCCAGACCAACCAATTCACA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

12 - Non Combustible Liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

常规特殊物品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yongchang Miao et al.
Cancer medicine, 9(19), 7231-7243 (2020-08-12)
Gastric cancer (GC) is one of the most deadly malignancies at global scale, and is particularly common in eastern Asia. MicroRNA-5683 (miR-5683) was confirmed to be downregulated in GC by analyzing data from the Cancer Genome Atlas. We packaged miR-5683-mimics
D Leclerc et al.
British journal of cancer, 116(7), 930-936 (2017-02-17)
Cancer cells maintain high rates of glycolysis. Pyruvate dehydrogenase kinases (PDK) contribute to this phenomenon, which favours apoptosis resistance and cellular transformation. We previously reported upregulation of PDK4 in normal mucosa of colorectal cancer (CRC) patients compared with controls and
Peng Zhang et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 32(7), 3924-3935 (2018-03-06)
Prostate cancer (PCa) represents one of the most common solid neoplasms, and metastasis is the second leading cause of death in adult males. Anoikis is a programmed cell death that is induced upon cell detachment from the extracellular matrix (ECM)
Yukihiro Tambe et al.
Molecular carcinogenesis, 58(10), 1726-1737 (2019-05-21)
Phosphorylation of pyruvate dehydrogenase by pyruvate dehydrogenase kinase 4 (PDK4) 4 inhibits its ability to induce a glycolytic shift. PDK4 expression is frequently upregulated in various cancer tissues, with its elevation being critical for the induction of the Warburg effect.
Xiaohui Liu et al.
Scientific reports, 7(1), 8474-8474 (2017-08-18)
Pyruvate dehydrogenase kinase (PDK) is known as a gatekeeper directing the carbon flux into glycolysis via inhibition of the pyruvate dehydrogenase complex. During syncytialization of placental trophoblasts, both ATP production and oxygen consumption are increased to meet enhanced energetic demands

Related Content

Instructions

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service