Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TTTTGCTTTGGAGGATGAAAGTTATGAGATATATGTTGAAGACTTGAAAAAAGATGAAAAGAAAGATAAGGTGTTACTGAGTTACTATGAGTCTCAACACCCCTCAAATGAATCAGGTGACGGTGTTGATGGTAAGATGTTAATGGTAACCCTGAGTCCTACAAAAGACTTCTGGTTGCATGCCAACAACAAGGAACACTCTGTGGAGCTCCATAAGTGTGAAAAACCACTGCCAGACCAGGCCTTCTTTGTCCTTCATAATATGCACTCCAACTGTGTTTCATTTGAATGCAAGACTGATCCTGGAGTGTTTATAGGTGTAAAGGATAATCATCTTGCTCTGATTAAAGTAGACTCTTCTGAGAATTTGTGTACTGAAAATATCTTGTTTAAGCTCTCTGAAACTTAGTTGATGGAAACCTGTGAGTCTTGGG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... IL33(90865)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Related Content
Instructions
Haiyan Hu et al.
Biochemical and biophysical research communications, 485(3), 643-650 (2017-02-22)
Breast cancers with estrogen receptor (ER) expressions account for the majority of all clinical cases. Due to hormone therapy with tamoxifen, prognoses of patients with ER-positive breast cancer are significantly improved. However, endocrine resistance to tamoxifen is common and inevitable
Weronika Gonciarz et al.
International journal of molecular sciences, 21(5) (2020-03-11)
Interleukin (IL)-33 is a proinflammatory mediator that alerts the host immune system to disorders in tissue homeostasis. Aim. To understand the role of IL-33 in modulating gastric tissue cell growth affected by Helicobacter pylori (H. pylori). Methods. IL-33 production in
Meng Li et al.
International journal of molecular sciences, 22(5) (2021-03-07)
Short-chain fatty acids (e.g., butyrate and propionate) are able to diminish endothelial cell activation. The aim of this study was to investigate whether intracellular IL-33 mediates the effects of butyrate and propionate on TNFα-induced IL-8 production and vascular cell adhesion
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU008491-50UG | 04061828455133 |
| EHU008491-20UG | 04061828678570 |