Skip to Content
Merck
CN

EHU009271

MISSION® esiRNA

targeting human PPM1D

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTGTCAGAGCTGTGGAGGTGACACAGGACCATAAGCCAGAACTTCCCAAGGAAAGAGAACGAATCGAAGGACTTGGTGGGAGTGTAATGAACAAGTCTGGGGTGAATCGTGTAGTTTGGAAACGACCTCGACTCACTCACAATGGACCTGTTAGAAGGAGCACAGTTATTGACCAGATTCCTTTTCTGGCAGTAGCAAGAGCACTTGGTGATTTGTGGAGCTATGATTTCTTCAGTGGTGAATTTGTGGTGTCACCTGAACCAGACACAAGTGTCCACACTCTTGACCCTCAGAAGCACAAGTATATTATATTGGGGAGTGATGGACTTTGGAATATGATTCCACCACAAGATGCCATCTCAATGTGCCAGGACCAAGAGGAGAAAAAATACCTGATGGGTGAGCATGGACAATCTTGTGCCAAAATGCTTGTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PPM1D(8493)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品

This item has


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Zhong-Wu Lu et al.
Oncology reports, 43(3), 783-794 (2020-01-11)
Endeavors towards identifying key molecular markers for early diagnosis and treatment are driving the clinical study of papillary thyroid carcinoma (PTC). Recent studies have indicated that protein phosphatase, Mg2+/Mn2+ dependent, 1D (PPM1D) exerts an oncogenic function by increasing cell proliferation, migration
Chen Chen et al.
Journal of Cancer, 11(11), 3216-3224 (2020-04-02)
Accumulated studies showed that numerous microRNAs (miRNAs) were aberrantly expressed in human intrahepatic cholangiocarcinoma (ICC) and contributed to the tumorigenic processes. However, whether miR-129-2-3p is implicated in the ICC initiation and progression is still limited. Here, the results revealed that
Shigeo Ohba et al.
Cell reports, 31(2), 107518-107518 (2020-04-16)
The metabolic enzyme phosphoglycerate mutase 1 (PGAM1) is overexpressed in several types of cancer, suggesting an additional function beyond its established role in the glycolytic pathway. We here report that PGAM1 is overexpressed in gliomas where it increases the efficiency
Jin Ju Park et al.
Technology in cancer research & treatment, 19, 1533033820964425-1533033820964425 (2020-10-24)
Several techniques have been employed for deletion of the NKX3.1 gene, resulting in developmental defects of the prostate, including alterations in ductal branching morphogenesis and prostatic secretions as well as epithelial hyperplasia and dysplasia. To investigate whether the CRISPR/Cas9-mediated technique
Dong-Seok Park et al.
EMBO reports, 21(5), e48693-e48693 (2020-02-28)
The tumor suppressor Smad4, a key mediator of the TGF-β/BMP pathways, is essential for development and tissue homeostasis. Phosphorylation of Smad4 in its linker region catalyzed by the mitogen-activated protein kinase (MAPK) plays a pivotal role in regulating its transcriptional

Related Content

Instructions

Global Trade Item Number

SKUGTIN
EHU009271-20UG04061828671694
EHU009271-50UG04061831370652

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service