Skip to Content
Merck
CN

EHU009491

MISSION® esiRNA

targeting human ZC3H12A

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CACAGTGTTTGTGCCATCCTGGAGGAAGGAGCAGCCTCGGCCCGACGTGCCCATCACAGACCAGCACATCCTGCGGGAACTGGAGAAGAAGAAGATCCTGGTGTTCACACCATCACGACGCGTGGGTGGCAAGCGGGTGGTGTGCTATGACGACAGATTCATTGTGAAGCTGGCCTACGAGTCTGACGGGATCGTGGTTTCCAACGACACATACCGTGACCTCCAAGGCGAGCGGCAGGAGTGGAAGCGCTTCATCGAGGAGCGGCTGCTCATGTACTCCTTCGTCAATGACAAGTTTATGCCCCCTGATGACCCACTGGGCCGGCACGGGCCCAGCCTGGACAACTTCCTGCGTAAGAAGCCACTCACTTTGGAGCACAGGAAGCAGCCGTGTCCCTATGGAAGGAAATGCACCTATGGGATCAAGTGCCGAT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

12 - Non Combustible Liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Min Li et al.
Medical microbiology and immunology, 207(1), 27-38 (2017-10-19)
Monocyte chemotactic protein-induced protein 1(MCPIP1) is identified as an important inflammatory regulator during immune response. MCPIP1 possesses antiviral activities against several viruses, such as Japanese encephalitis. However, its role on Coxsackievirus B3 (CVB3) infection, a positive-stranded RNA virus, has not
You-Take Oh et al.
Oncogene, 37(25), 3415-3425 (2018-03-20)
Monocyte chemotactic protein-induced protein-1 (MCPIP1; also called Regnase-1) encoded by the ZC3H12A gene critically regulates inflammatory responses and immune homeostasis primarily by RNase-dependent and -independent mechanisms. However, the relationship of MCPIP1 with apoptosis and cancer and the underlying mechanisms are
Zhuqing Jin et al.
International journal of molecular sciences, 20(1) (2019-01-10)
MCP-1-induced protein (MCPIP, also known as Zc3h12a or Regnase-1), a newly identified suppressor of cytokine signaling, is expressed in endothelial cells (ECs). To investigate the role of endothelial MCPIP in vascular homeostasis and function, we deleted the MCPIP gene specifically
Nidhi Kapoor et al.
Journal of immunology (Baltimore, Md. : 1950), 194(12), 6011-6023 (2015-05-03)
Macrophage polarization plays a critical role in tissue homeostasis, disease pathogenesis, and inflammation and its resolution. IL-4-induced macrophage polarization involves induction of STAT6 and Krüppel-like factor 4 (KLF4), which induce each other and promote M2 polarization. However, how these transcription

Related Content

Instructions

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service