Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CACAGTGTTTGTGCCATCCTGGAGGAAGGAGCAGCCTCGGCCCGACGTGCCCATCACAGACCAGCACATCCTGCGGGAACTGGAGAAGAAGAAGATCCTGGTGTTCACACCATCACGACGCGTGGGTGGCAAGCGGGTGGTGTGCTATGACGACAGATTCATTGTGAAGCTGGCCTACGAGTCTGACGGGATCGTGGTTTCCAACGACACATACCGTGACCTCCAAGGCGAGCGGCAGGAGTGGAAGCGCTTCATCGAGGAGCGGCTGCTCATGTACTCCTTCGTCAATGACAAGTTTATGCCCCCTGATGACCCACTGGGCCGGCACGGGCCCAGCCTGGACAACTTCCTGCGTAAGAAGCCACTCACTTTGGAGCACAGGAAGCAGCCGTGTCCCTATGGAAGGAAATGCACCTATGGGATCAAGTGCCGAT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... ZC3H12A(80149)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
12 - Non Combustible Liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Related Content
Instructions
Min Li et al.
Medical microbiology and immunology, 207(1), 27-38 (2017-10-19)
Monocyte chemotactic protein-induced protein 1(MCPIP1) is identified as an important inflammatory regulator during immune response. MCPIP1 possesses antiviral activities against several viruses, such as Japanese encephalitis. However, its role on Coxsackievirus B3 (CVB3) infection, a positive-stranded RNA virus, has not
You-Take Oh et al.
Oncogene, 37(25), 3415-3425 (2018-03-20)
Monocyte chemotactic protein-induced protein-1 (MCPIP1; also called Regnase-1) encoded by the ZC3H12A gene critically regulates inflammatory responses and immune homeostasis primarily by RNase-dependent and -independent mechanisms. However, the relationship of MCPIP1 with apoptosis and cancer and the underlying mechanisms are
Zhuqing Jin et al.
International journal of molecular sciences, 20(1) (2019-01-10)
MCP-1-induced protein (MCPIP, also known as Zc3h12a or Regnase-1), a newly identified suppressor of cytokine signaling, is expressed in endothelial cells (ECs). To investigate the role of endothelial MCPIP in vascular homeostasis and function, we deleted the MCPIP gene specifically
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU009491-50UG | 04061828445936 |
| EHU009491-20UG | 04061828671892 |