Skip to Content
Merck
CN

EHU009781

Sigma-Aldrich

MISSION® esiRNA

targeting human NRIP1

Sign Into View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGGAAGAGGCTGTCTGATTCTATCATGAATTTAAACGTAAAGAAGGAAGCTTTGCTAGCTGGCATGGTTGACAGTGTGCCTAAAGGCAAACAGGATAGCACATTACTGGCCTCTTTGCTTCAGTCATTCAGCTCTAGGCTGCAGACTGTTGCTCTGTCACAACAAATCAGGCAGAGCCTCAAGGAGCAAGGATATGCCCTCAGTCATGATTCTTTAAAAGTGGAGAAGGATTTAAGGTGCTATGGTGTTGCATCAAGTCACTTAAAAACTTTGTTGAAGAAAAGTAAAGTTAAAGATCAAAAGCCTGATACGAATCTTCCTGATGTGACTAAAAACCTCATCAGAGATAGGTTTGCAGAGTCTCCTCATCATGTTGGACAAAGTGGAACAAAGGTCATGAGTGAACCGTTGTCATGTGCTGCAAGATTACAGGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Hongying Piao et al.
The journal of physiological sciences : JPS, 67(1), 141-150 (2016-03-28)
Estrogen withdrawal following menopause results in an increase of osteoclasts formation and bone resorption, which is one of the most important mechanisms of postmenopausal osteoporosis. Recently, growing evidence has suggested that receptor-interacting protein 140 was implicated in estrogen-regulated metabolic disease
X F Ni et al.
Neoplasma, 65(6), 881-887 (2018-06-27)
Nuclear receptor interacting protein (NRIP1), also known as RIP140, is a transcriptional co-regulator required for the maintenance of energy homeostasis and ovulation. Although several studies have identified roles for NRIP1 in various cell processes, the biological functions of NRIP1 in
J You et al.
Acta physiologica (Oxford, England), 220(1), 58-71 (2016-09-11)
The transcriptional cofactor receptor-interacting protein 140 (RIP140) is known as a deleterious regulator of cardiac mitochondrial function and energy metabolic homeostasis. This study revealed that RIP140 repressed Sirtuin 3 (SIRT3), a mitochondrial deacetylase that plays an important role in regulating

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service