Merck
CN
All Photos(1)

Documents

Safety Information

EHU009821

Sigma-Aldrich

MISSION® esiRNA

targeting human CHRM1

Sign Into View Organizational & Contract Pricing
All Photos(1)
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TAGCCACAGTGACAGGCAACCTGCTGGTACTCATCTCTTTCAAGGTCAACACGGAGCTCAAGACAGTCAATAACTACTTCCTGCTGAGCCTGGCCTGTGCTGACCTCATCATCGGTACCTTCTCCATGAACCTCTATACCACGTACCTGCTCATGGGCCACTGGGCTCTGGGCACGCTGGCTTGTGACCTCTGGCTGGCCCTGGACTATGTGGCCAGCAATGCCTCCGTCATGAATCTGCTGCTCATCAGCTTTGACCGCTACTTCTCCGTGACTCGGCCCCTGAGCTACCGTGCCAAGCGCACACCCCGCCGGGCAGCTCTGATGATCGGCCTGGCCTGGCTGGTTTCCTTTGTGCTCTGGGCCCCAGCCATCCTCTTCTGGCAGTACCTGGTAGGGGAGCGGACAGTGCTAGCTGGGCAGTGCTACATCCAGTTCCTCTCCCAGCCCATCATCACCTTTGGCACAGCCATGGCTGCCTTCTACCTCCCTGTCACAGTCATGTGCACGCTCTACTGGCGCATCTACC

Ensembl | human accession no.

ENSG00000168539

NCBI accession no.

NM_000738

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CHRM1(1128) , CHRM1(1128)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Documents related to the products that you have purchased in the past have been gathered in the Document Library for your convenience.

Visit the Document Library

Difficulty Finding Your Product Or Lot/Batch Number?

Product numbers are combined with Pack Sizes/Quantity when displayed on the website (example: T1503-25G). Please make sure you enter ONLY the product number in the Product Number field (example: T1503).

Example:

T1503
Product Number
-
25G
Pack Size/Quantity

Additional examples:

705578-5MG-PW

PL860-CGA/SHF-1EA

MMYOMAG-74K-13

1000309185

enter as 1.000309185)

Having trouble? Feel free to contact Technical Service for assistance.

Lot and Batch Numbers can be found on a product's label following the words 'Lot' or 'Batch'.

Aldrich Products

  • For a lot number such as TO09019TO, enter it as 09019TO (without the first two letters 'TO').

  • For a lot number with a filling-code such as 05427ES-021, enter it as 05427ES (without the filling-code '-021').

  • For a lot number with a filling-code such as STBB0728K9, enter it as STBB0728 without the filling-code 'K9'.

Not Finding What You Are Looking For?

In some cases, a COA may not be available online. If your search was unable to find the COA you can request one.

Request COA

Deyu Zeng et al.
Journal of cellular biochemistry, 119(2), 1855-1865 (2017-08-13)
Pancreatic cancer is one of the major human malignant tumors severely endangering human health and life with high mortality due to the concealment of early symptoms and lack of effective therapies during advanced stages. The identification of pancreatic cancer stem
Jingjing Zhang et al.
Gynecologic and obstetric investigation, 84(5), 485-494 (2019-05-01)
The aim of this study was to investigate the expression of Forkhead box M1 (FoxM1) in endometriosis and determine FoxM1's possible effects on endometriotic epithelial cells (EECs) invasion and epithelial-mesenchymal transition (EMT). The expression of FoxM1 and E-cadherin in endometrium
Liang Guo et al.
Cell cycle (Georgetown, Tex.), 16(18), 1705-1718 (2017-08-03)
Ubiquitin-conjugating enzyme E2C (UBE2C) is characterized as a crucial molecule in cancer cell growth that plays an essential role in the development of gliomas, but the detailed mechanisms have not been fully elucidated. In this study, we found that Forkhead
Tao Wang et al.
Molecular and cellular biochemistry, 413(1-2), 179-187 (2016-01-29)
The prolyl isomerase Pin1, which is frequently highly expressed in many different cancers, can directly regulate cell proliferation and the cell cycle. However, the role of Pin1 in chemo-resistance remains to be elucidated in cervical cancer. The purpose of the
Xue Zhu et al.
Acta biochimica et biophysica Sinica, 50(9), 914-920 (2018-07-31)
Carboplatin is the most commonly used drug in the first-line treatment of human retinoblastoma (RB), but its clinical application is greatly limited due to acquired drug resistance upon the long-term treatment. Forkhead box protein M1 (FoxM1) is the transcription factor
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service