Skip to Content
Merck
CN

EHU010441

MISSION® esiRNA

targeting human VDR

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCAGTTCGTGTGAATGATGGTGGAGGGAGCCATCCTTCCAGGCCCAACTCCAGACACACTCCCAGCTTCTCTGGGGACTCCTCCTCCTCCTGCTCAGATCACTGTATCACCTCTTCAGACATGATGGACTCGTCCAGCTTCTCCAATCTGGATCTGAGTGAAGAAGATTCAGATGACCCTTCTGTGACCCTAGAGCTGTCCCAGCTCTCCATGCTGCCCCACCTGGCTGACCTGGTCAGTTACAGCATCCAAAAGGTCATTGGCTTTGCTAAGATGATACCAGGATTCAGAGACCTCACCTCTGAGGACCAGATCGTACTGCTGAAGTCAAGTGCCATTGAGGTCATCATGTTGCGCTCCAATGAGTCCTTCACCATGGACGACATGTCCTGGACCTGTGGCAACCAAGACTACAAGTACCGCGTCAGTGACGTGACCAAAGCCGGACACAGCCTGGAGCTGATTGAGCCCCTCATCAAGTTCCAGGTGGGACTGAAGAAGCTGAACTTGCATGAGGAGGAGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

常规特殊物品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yang Gao et al.
International journal of molecular medicine, 46(4), 1538-1550 (2020-09-19)
Psoriasis is an immune‑mediated dermatosis characterized by T‑lymphocyte‑mediated epidermal hyperplasia, for which there are currently no effective clinical treatments. 'Psoriasis 1' is a Chinese herbal medicine formulation that has been recently used extensively in China for treating patients with psoriasis. However
Ken-ichiro Tanaka et al.
Biochemical and biophysical research communications, 450(1), 482-487 (2014-06-14)
Vitamin D deficiency and advanced glycation end products (AGEs) are suggested to be involved in the pathogenesis of osteoporosis and sarcopenia. However, the effects of vitamin D and AGEs on myogenesis and the interaction between muscle and bone remains still
Lars Brodowski et al.
PloS one, 9(6), e98527-e98527 (2014-06-03)
Placenta-derived circulating factors contribute to the maternal endothelial dysfunction underlying preeclampsia. Endothelial colony forming cells (ECFC), a sub-population of endothelial progenitor cells (EPCs), are thought to be involved in vasculogenesis and endothelial repair. Low vitamin D concentrations are associated with
Aurélien Mary et al.
Endocrinology, 156(6), 1965-1974 (2015-03-13)
Vascular calcification (VC) is a degenerative disease that contributes to cardiovascular morbidity and mortality. A negative relationship has been demonstrated between VC and calcium sensing receptor (CaSR) expression in the vasculature. Of interest, vitamin D response elements, which allow responsiveness
T P H Nguyen et al.
Journal of molecular medicine (Berlin, Germany), 93(7), 795-805 (2015-02-27)
Fetal growth restriction (FGR) affects up to 5 % of pregnancies worldwide, and trophoblast function plays a significant role on the outcome. An epidemiological study has linked vitamin D deficiency to adverse perinatal outcomes, which include decreased birth weight. The

Related Content

Instructions

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service