Skip to Content
Merck
CN

EHU011031

MISSION® esiRNA

targeting human TLR7

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

Product Name

MISSION® esiRNA, targeting human TLR7

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGAAGTTGGCTTCTGCTCAAATGCCAGAACTTCTGTAGAAAGTTATGAACCCCAGGTCCTGGAACAATTACATTATTTCAGATATGATAAGTATGCAAGGAGTTGCAGATTCAAAAACAAAGAGGCTTCTTTCATGTCTGTTAATGAAAGCTGCTACAAGTATGGGCAGACCTTGGATCTAAGTAAAAATAGTATATTTTTTGTCAAGTCCTCTGATTTTCAGCATCTTTCTTTCCTCAAATGCCTGAATCTGTCAGGAAATCTCATTAGCCAAACTCTTAATGGCAGTGAATTCCAACCTTTAGCAGAGCTGAGATATTTGGACTTCTCCAACAACCGGCTTGATTTACTCCATTCAACAGCATTTGAAGAGCTTCACAAACTGGAAGTTCTGGATATAAGCAGTAATAGCCATTATTTTCAATCAGAAGGAATTACTCATATGCTAAACTTTACCAAGAACCTAAAGGTTCTGCAGAAACTGATGATGAACGACAATGACATCTCTTCCTCCACCAGCAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Nuoyan Zheng et al.
JCI insight, 5(14) (2020-07-24)
TLR7 has been linked to the pathogenesis of glomerulonephritis, but its precise roles are not clear. In this study, we evaluated the roles of TLR7 in IgA nephropathy (IgAN). TLR7 proteins were abundant in CD19+ B cells infiltrated in the
Yayi Huang et al.
Revista da Associacao Medica Brasileira (1992), 65(8), 1067-1073 (2019-09-19)
Diabetes is a risk factor for acute kidney injury (AKI). However, its mechanism of pathogenesis has not been elucidated. The aim of the study was to investigate the role of inflammation and the toll-like receptor 7 (TLR7) in ischemic AKI
Federica Liotti et al.
Cancers, 13(4) (2021-02-14)
Pattern recognition receptors (PRR) promote inflammation but also its resolution. We demonstrated that a specific PRR-formyl peptide receptor 1 (FPR1)-sustains an inflammation resolution response with anti-angiogenic and antitumor potential in gastric cancer. Since toll-like receptor 7 (TLR7) is crucial in
Yun-Ru Liao et al.
Biochemical and biophysical research communications, 493(2), 1136-1142 (2017-08-28)
Diabetic retinopathy (DR) is a major microvascular complication of diabetes, resulting in neuronal dysfunction, retinal vascular leakage, and apoptosis within the retina. Innate immunity plays an important role in the pathogenesis of type 2 diabetes (T2D) and related complications. The
Ryoichiro Nishibayashi et al.
PloS one, 10(6), e0129806-e0129806 (2015-06-18)
Interleukin-12 (IL-12) is an important cytokine for the immunomodulatory effects of lactic acid bacteria (LAB). Using murine immune cells, we previously reported that the RNA of Enterococcus faecalis EC-12, a LAB strain exerting probiotic-like beneficial effects, is the major IL-12-inducing

Related Content

Instructions

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service