Skip to Content
Merck
CN

EHU011701

MISSION® esiRNA

targeting human CARTPT

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACGAGAAGGAGCTGATCGAAGCGCTGCAAGAAGTCTTGAAGAAGCTCAAGAGTAAACGTGTTCCCATCTATGAGAAGAAGTATGGCCAAGTCCCCATGTGTGACGCCGGTGAGCAGTGTGCAGTGAGGAAAGGGGCAAGGATCGGGAAGCTGTGTGACTGTCCCCGAGGAACCTCCTGCAATTCCTTCCTCCTGAAGTGCTTATGAAGGGGCGTCCATTCTCCTCCATACATCCCCATCCCTCTACTTTCCCCAGAGGACCACACCTTCCTCCCTGGAGTTTGGCTTAAGCAACAGATAAAGTTTTTATTTTCCTCTGAAGGGAAAGGGCTCTTTTCCTGCTGTTTCAAAAATAAAAGAACACATTAGATGTTACTGTGTGAAGAATAATGCCTTGTATGGTGTTGATACGTGTGTGAAGTATTCTTATTTTATTTGTCTGACAAACTCTTGTGTACCTTTGTGTAAAGAAGGGAAGCTTTGTTTGAAAATTGTATTTTTGTATGTGGCATGGCAGAAT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

L Shcherbina et al.
Molecular and cellular endocrinology, 447, 52-60 (2017-02-27)
Impaired beta-cell function is key to the development of type 2 diabetes. Cocaine- and amphetamine-regulated transcript (CART) is an islet peptide with insulinotropic and glucagonostatic properties. Here we studied the role of endogenous CART in beta-cell function. CART silencing in
Ji-Yao Li et al.
Journal of neurophysiology, 121(3), 928-939 (2019-01-17)
Hyperphagia is common in diabetes and may worsen hyperglycemia and diabetic complications. The responsible mechanisms are not well understood. The hypothalamus is a key center for the control of appetite and energy homeostasis. The ventromedial nucleus (VMH) and arcuate nucleus
Shin J Lee et al.
Cell reports, 30(6), 2028-2039 (2020-02-13)
The vagus nerve conveys gastrointestinal cues to the brain to control eating behavior. In obesity, vagally mediated gut-brain signaling is disrupted. Here, we show that the cocaine- and amphetamine-regulated transcript (CART) is a neuropeptide synthesized proportional to the food consumed

Related Content

Instructions

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service