Skip to Content
Merck
CN

EHU012921

Sigma-Aldrich

MISSION® esiRNA

targeting human ABCG2

Sign Into View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTATCCGTGGTGTGTCTGGAGGAGAAAGAAAAAGGACTAGTATAGGAATGGAGCTTATCACTGATCCTTCCATCTTGTTCTTGGATGAGCCTACAACTGGCTTAGACTCAAGCACAGCAAATGCTGTCCTTTTGCTCCTGAAAAGGATGTCTAAGCAGGGACGAACAATCATCTTCTCCATTCATCAGCCTCGATATTCCATCTTCAAGTTGTTTGATAGCCTCACCTTATTGGCCTCAGGAAGACTTATGTTCCACGGGCCTGCTCAGGAGGCCTTGGGATACTTTGAATCAGCTGGTTATCACTGTGAGGCCTATAATAACCCTGCAGACTTCTTCTTGGACATCATTAATGGAGATTCCACTGCTGTGGCATTAAACAGAGAAGAAGACTTTAAAGCCACAGAGATCATAGAGCCTTCCAAGCAGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Long Chen et al.
Oncotarget, 8(26), 43237-43247 (2017-06-08)
We analyzed the role of ABCG2, a drug transporter, in determining the sensitivity of glioma stem cells (GSCs) to demethoxycurcumin (DMC). We first demonstrated that ABCG2 is more highly expressed in GSCs than primary astrocytes. Modulation of ABCG2 levels in
Hisakazu Komori et al.
Biochimica et biophysica acta, 1860(5), 973-980 (2018-01-11)
Hyperuricemia has been recognized as an independent risk factor for cardiovascular disease. Urate stimulates NADPH oxidase and induces production of reactive oxygen species (ROS); consequently, intracellular urate accumulation can induce oxidative stress leading to endothelial dysfunction. Here, we studied the
Simran Kaur et al.
Infection, genetics and evolution : journal of molecular epidemiology and evolutionary genetics in infectious diseases, 87, 104662-104662 (2020-12-06)
The lengthy TB chemotherapeutic regimen, resulting in the emergence of drug resistance strains, poses a serious problem in the cure of the disease. Further, one-quarter of the world's population is infected with dormant M.tb, which creates a lifetime risk of
Junqing Wang et al.
Oncotarget, 8(3), 5256-5267 (2016-12-29)
ABCG2, member of ATP-binding cassette (ABC) transporter family, is known as crucial regulator related to multi-drug resistance in human tumors and has recently been putatively studied as human carcinoma cell biomarker. While, effects of ABCG2 on human gastric cancer (GC)
Kang Xu et al.
Phytotherapy research : PTR, 33(6), 1717-1725 (2019-04-25)
Inflammation is considered to be one of the initial critical factors in the occurrence of calcific heart valve disease. This study was to prove Nobiletin (NBT) inhibits inflammation-caused calcification of human valve interstitial cells (hVICs) and to elucidate the involved

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service