Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TTATCCGTGGTGTGTCTGGAGGAGAAAGAAAAAGGACTAGTATAGGAATGGAGCTTATCACTGATCCTTCCATCTTGTTCTTGGATGAGCCTACAACTGGCTTAGACTCAAGCACAGCAAATGCTGTCCTTTTGCTCCTGAAAAGGATGTCTAAGCAGGGACGAACAATCATCTTCTCCATTCATCAGCCTCGATATTCCATCTTCAAGTTGTTTGATAGCCTCACCTTATTGGCCTCAGGAAGACTTATGTTCCACGGGCCTGCTCAGGAGGCCTTGGGATACTTTGAATCAGCTGGTTATCACTGTGAGGCCTATAATAACCCTGCAGACTTCTTCTTGGACATCATTAATGGAGATTCCACTGCTGTGGCATTAAACAGAGAAGAAGACTTTAAAGCCACAGAGATCATAGAGCCTTCCAAGCAGG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... ABCG2(9429)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Related Content
Instructions
Junqing Wang et al.
Oncotarget, 8(3), 5256-5267 (2016-12-29)
ABCG2, member of ATP-binding cassette (ABC) transporter family, is known as crucial regulator related to multi-drug resistance in human tumors and has recently been putatively studied as human carcinoma cell biomarker. While, effects of ABCG2 on human gastric cancer (GC)
Hisakazu Komori et al.
Biochimica et biophysica acta, 1860(5), 973-980 (2018-01-11)
Hyperuricemia has been recognized as an independent risk factor for cardiovascular disease. Urate stimulates NADPH oxidase and induces production of reactive oxygen species (ROS); consequently, intracellular urate accumulation can induce oxidative stress leading to endothelial dysfunction. Here, we studied the
Long Chen et al.
Oncotarget, 8(26), 43237-43247 (2017-06-08)
We analyzed the role of ABCG2, a drug transporter, in determining the sensitivity of glioma stem cells (GSCs) to demethoxycurcumin (DMC). We first demonstrated that ABCG2 is more highly expressed in GSCs than primary astrocytes. Modulation of ABCG2 levels in
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU012921-50UG | 04061828449262 |
| EHU012921-20UG | 04061831361612 |