Skip to Content
Merck
CN

EHU013781

MISSION® esiRNA

targeting human VEGFC

Sign In to View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGCAAAGATCTGGAGGAGCAGTTACGGTCTGTGTCCAGTGTAGATGAACTCATGACTGTACTCTACCCAGAATATTGGAAAATGTACAAGTGTCAGCTAAGGAAAGGAGGCTGGCAACATAACAGAGAACAGGCCAACCTCAACTCAAGGACAGAAGAGACTATAAAATTTGCTGCAGCACATTATAATACAGAGATCTTGAAAAGTATTGATAATGAGTGGAGAAAGACTCAATGCATGCCACGGGAGGTGTGTATAGATGTGGGGAAGGAGTTTGGAGTCGCGACAAACACCTTCTTTAAACCTCCATGTGTGTCCGTCTACAGATGTGGGGGTTGCTGCAATAGTGAGGGGCTGCAGTGCATGAACACCAGCACGAGCTACCTCAGCAAGACGTTATTTGAAATTACAGTGCCTCTCTCTCAAGGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

12 - Non Combustible Liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Bo Sun et al.
International journal of cancer, 145(6), 1648-1659 (2019-02-09)
The lymphatic network remodeling may guide tumor metastasis in a sentinel lymph node (SLN). Although tumor-derived exosomes have been demonstrated to modify the microenvironment in adjacent organs and initiate a premetastatic niche, their influence on the lymphatic network in SLNs
Signe R Michaelsen et al.
Neuro-oncology, 20(11), 1462-1474 (2018-06-26)
Glioblastoma ranks among the most lethal cancers, with current therapies offering only palliation. Paracrine vascular endothelial growth factor (VEGF) signaling has been targeted using anti-angiogenic agents, whereas autocrine VEGF/VEGF receptor 2 (VEGFR2) signaling is poorly understood. Bevacizumab resistance of VEGFR2-expressing
Erin Regan et al.
PloS one, 11(3), e0150963-e0150963 (2016-03-08)
It is well established that lung tumors induce the formation of lymphatic vessels. However, the molecular mechanisms controlling tumor lymphangiogenesis in lung cancer have not been fully delineated. In the present study, we identify a panel of non-small cell lung

Related Content

Instructions

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service