Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AGCAAAGATCTGGAGGAGCAGTTACGGTCTGTGTCCAGTGTAGATGAACTCATGACTGTACTCTACCCAGAATATTGGAAAATGTACAAGTGTCAGCTAAGGAAAGGAGGCTGGCAACATAACAGAGAACAGGCCAACCTCAACTCAAGGACAGAAGAGACTATAAAATTTGCTGCAGCACATTATAATACAGAGATCTTGAAAAGTATTGATAATGAGTGGAGAAAGACTCAATGCATGCCACGGGAGGTGTGTATAGATGTGGGGAAGGAGTTTGGAGTCGCGACAAACACCTTCTTTAAACCTCCATGTGTGTCCGTCTACAGATGTGGGGGTTGCTGCAATAGTGAGGGGCTGCAGTGCATGAACACCAGCACGAGCTACCTCAGCAAGACGTTATTTGAAATTACAGTGCCTCTCTCTCAAGGC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... VEGFC(7424)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
12 - Non Combustible Liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Related Content
Instructions
Bo Sun et al.
International journal of cancer, 145(6), 1648-1659 (2019-02-09)
The lymphatic network remodeling may guide tumor metastasis in a sentinel lymph node (SLN). Although tumor-derived exosomes have been demonstrated to modify the microenvironment in adjacent organs and initiate a premetastatic niche, their influence on the lymphatic network in SLNs
Signe R Michaelsen et al.
Neuro-oncology, 20(11), 1462-1474 (2018-06-26)
Glioblastoma ranks among the most lethal cancers, with current therapies offering only palliation. Paracrine vascular endothelial growth factor (VEGF) signaling has been targeted using anti-angiogenic agents, whereas autocrine VEGF/VEGF receptor 2 (VEGFR2) signaling is poorly understood. Bevacizumab resistance of VEGFR2-expressing
Erin Regan et al.
PloS one, 11(3), e0150963-e0150963 (2016-03-08)
It is well established that lung tumors induce the formation of lymphatic vessels. However, the molecular mechanisms controlling tumor lymphangiogenesis in lung cancer have not been fully delineated. In the present study, we identify a panel of non-small cell lung
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU013781-20UG | 04061831361797 |
| EHU013781-50UG | 04061831370782 |