Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
ATCAGAGTCGCAGCTTTCGTTCCGCCGCTCGCCGACAAAGTCCTCGCTGGATTACCGTCGCCTGCCCGATGCCCATTCCGATTACGCACGCTATTCGGGCTCCTATAATGATTACCTGCGGGCGGCTCAGATGCACTCTGGCTACCAGCGCCGCATGTAGGGCCATCCTGGGATGGGGCACCACAGGGAGGGAGGGAGAAAAGAGGTGGGTAGGGTTACAGATCCAGGTTATAACTACTCTGGCCCATACCTTTCCTGGTTGTGGTTTTTCATGCCCTCTACCATGTGGGCCTTCCCCAGGAGATGATCCTGTTAAGTGTTCGGCAGTAACCTACTTTGTTCCTTCGCCTCAGCAGCAAATCTTGCTACTGGCTCTAGATCTGCGGTTTCCCCTCTACCCTGCCTCCCGTCTCCCCAGAATGGGAATT
Ensembl | human accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... RBM14(10432)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Related Content
Instructions
Song Gao et al.
International journal of oncology, 54(6), 1921-1932 (2019-05-14)
Osteosarcoma (OS) is a common primary malignancy in adolescents and children. MicroRNAs (miRNAs or miRs) can regulate the progression of OS. Herein, we explored the target genes and effects of miR‑9 in OS. Cell growth, colony formation and cell cycle
Tapasi Rana et al.
American journal of respiratory cell and molecular biology, 62(3), 319-330 (2019-09-13)
Senescence of alveolar type II (ATII) cells, progenitors of the alveolar epithelium, is a pathological feature and contributes importantly to the pathogenesis of idiopathic pulmonary fibrosis. Despite recognition of the importance of ATII cell senescence in idiopathic pulmonary fibrosis pathogenesis
S Kagawa et al.
Oncogene, 34(18), 2347-2359 (2014-06-17)
Notch activity regulates tumor biology in a context-dependent and complex manner. Notch may act as an oncogene or a tumor-suppressor gene even within the same tumor type. Recently, Notch signaling has been implicated in cellular senescence. Yet, it remains unclear
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU014081-20UG | 04061828687176 |
| EHU014081-50UG | 04061828687183 |