Skip to Content
Merck
CN

EHU014811

MISSION® esiRNA

targeting human CYP1B1

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

Product Name

MISSION® esiRNA, targeting human CYP1B1

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGTCCTGGCCTTCCTTTATGAAGCCATGCGCTTCTCCAGCTTTGTGCCTGTCACTATTCCTCATGCCACCACTGCCAACACCTCTGTCTTGGGCTACCACATTCCCAAGGACACTGTGGTTTTTGTCAACCAGTGGTCTGTGAATCATGACCCAGTGAAGTGGCCTAACCCGGAGAACTTTGATCCAGCTCGATTCTTGGACAAGGATGGCCTCATCAACAAGGACCTGACCAGCAGAGTGATGATTTTTTCAGTGGGCAAAAGGCGGTGCATTGGCGAAGAACTTTCTAAGATGCAGCTTTTTCTCTTCATCTCCATCCTGGCTCACCAGTGCGATTTCAGGGCCAACCCAAATGAGCCTGCGAAAATGAATTTCAGTTATGGTCTAACCATTAAACCCAAGTCATTTAAAGTCAATGTCACTCTCAGAGAGTCCATGGAGCTCCTTGATAGTGCTGTCCAAAATTTACAAGCCAAGGAAACTTGCCAATAAGAAGCAAGAGGCAAGCTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Francesca Cirillo et al.
Oncotarget, 8(63), 106608-106624 (2018-01-02)
The cytochrome P450 1B1 (CYP1B1) is a heme-thiolate monooxygenase involved in both estrogen biosynthesis and metabolism. For instance, CYP1B1 catalyzes the hydroxylation of E2 leading to the production of 4-hydroxyestradiol that may act as a potent carcinogenic agent. In addition
Inik Chang et al.
Oncotarget, 6(10), 7774-7787 (2015-04-11)
Despite high protein expression and enzymatic activity of cytochrome P450 1B1 (CYP1B1) in renal cell cancer (RCC), its functional significance has not been elucidated. Here we explored the functional role and regulatory mechanism of CYP1B1 in RCC. Reduction of CYP1B1
Yozo Mitsui et al.
BMC cancer, 15, 942-942 (2015-12-03)
Cytochrome P450 1B1 (CYP1B1) has been shown to be up-regulated in many types of cancer including renal cell carcinoma (RCC). Several reports have shown that CYP1B1 can influence the regulation of tumor development; however, its role in RCC has not

Related Content

Instructions

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service