Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AGTGAGCGGAAGAATGTGCTACAGTTGAAACTCCAGCAGCGCCGGACCCGGGAAGAACTGGTGAGCCAAGGGATCATGCCGCCTTTGAAAAGTCCAGCCGCATTTCATGAGCAGAGAAGGAGCTTGGAGCGGGCCAGGACAGAGGACTATCTCAAACGGAAGATTCGTTCCCGGCCGGAGAGATCGGAGCTGGTCAGGATGCACATTTTGGAAGAGACCTCGGCTGAGCCATCCCTCCAGGCCAAGCAGCTGAAGCTGAAGAGAGCCAGACTAGCCGATGACCTCAATGAGAAGATTGCACAGAGGCCTGGCCCCATGGAGCTGGTGGAGAAGAACATCCTTCCTGTTGAGTCCAGCCTGAAGGAAGCCATCATTGTGGGCCAGGTGAACTATCCCAAAGTAGCAGACAGCTCTTCCTTCGATGAGG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... MKL1(57591)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Related Content
Instructions
David Gau et al.
Angiogenesis, 20(4), 663-672 (2017-06-24)
De novo synthesis of cytoskeleton-regulatory proteins triggered by the megakaryoblastic leukemia (MKL)/serum response factor (SRF) transcriptional system in response to pro-angiogenic growth factors lies at the heart of endothelial cell (EC) migration (a critical element of angiogenesis) and neovascularization. This
Xu Shiwen et al.
PloS one, 10(5), e0126015-e0126015 (2015-05-09)
In scleroderma (systemic sclerosis, SSc), persistent activation of myofibroblast leads to severe skin and organ fibrosis resistant to therapy. Increased mechanical stiffness in the involved fibrotic tissues is a hallmark clinical feature and a cause of disabling symptoms. Myocardin Related
Philipp Kircher et al.
Science signaling, 8(402), ra112-ra112 (2015-11-12)
Megakaryoblastic leukemia 1 (MKL1) is a coactivator of serum response factor (SRF) that promotes the expression of genes associated with cell proliferation, motility, adhesion, and differentiation-processes that also involve dynamic cytoskeletal changes in the cell. MKL1 is inactive when bound
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU015721-20UG | 04061831339499 |
| EHU015721-50UG | 04061828339020 |