Skip to Content
Merck
CN

EHU015931

MISSION® esiRNA

targeting human CARD10

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GATCCTTCAGCAGCATGTCAGACATCACAGGGAGTGTGACACTTAAGCCCTGGTCCCCTGGCCTCTCTTCGTCCTCATCCTCTGACAGCGTGTGGCCTTTGGGAAAGCCGGAAGGCCTCCTGGCTCGGGGCTGTGGCCTGGACTTCCTCAACAGGTCTCTGGCTATTCGGGTGTCTGGCCGGAGCCCCCCAGGGGGCCCAGAGCCGCAGGACAAGGGACCAGATGGACTGTCGTTTTATGGGGACAGATGGTCTGGGGCTGTGGTGCGCAGGGTGCTGTCTGGGCCTGGGTCCGCCAGGATGGAACCAAGAGAGCAAAGGGTGGAAGCTGCTGGTCTGGAGGGGGCGTGCCTGGAAGCCGAGGCCCAGCAGAGAACCTTGCTCTGGAATCAGGGGTCCACACTCCCCTCCCTGATGGACTCGAAGGCCTGCCAGTCCTTCCACGAGGCCCTAGAAGCCTGGGCAAAGGGACCAGGTGCCGAGCCCTTCTACATTCGTGCCAACCTCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Pavithra Shyamsunder et al.
Haematologica, 103(8), 1269-1277 (2018-05-19)
Maturation of granulocytes is dependent on controlled gene expression by myeloid lineage restricted transcription factors. CEBPE is one of the essential transcription factors required for granulocytic differentiation. Identification of downstream targets of CEBPE is vital to understand better its role
Cheng-Shyuan Rau et al.
Toxicological sciences : an official journal of the Society of Toxicology, 140(2), 315-326 (2014-05-28)
This aim of this study was to explore the role of miRNA-146a (miR-146a) and its target genes in endothelial cells. We demonstrated that lipopolysaccharide (LPS) induced the upregulation of miR-146a in human umbilical vein endothelial cells (HUVECs), and that the
Benjamin Causton et al.
Journal of immunology (Baltimore, Md. : 1950), 195(2), 683-694 (2015-06-05)
Innate immune responses to allergens by airway epithelial cells (AECs) help initiate and propagate the adaptive immune response associated with allergic airway inflammation in asthma. Activation of the transcription factor NF-κB in AECs by allergens or secondary mediators via G

Related Content

Instructions

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service