Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GCCAGACTTGAAGCATGTCAAAAAGGTGTACAGCTGTGACCTTACGACGCTCGTGAAAGCACATACCACTAAGCGGCCAATGGTGGTAGACATGTGCATCAGGGAGATTGAGTCTAGAGGTCTTAATTCTGAAGGACTATACCGAGTATCAGGATTTAGTGACCTAATTGAAGATGTCAAGATGGCTTTCGACAGAGATGGTGAGAAGGCAGATATTTCTGTGAACATGTATGAAGATATCAACATTATCACTGGTGCACTTAAACTGTACTTCAGGGATTTGCCAATTCCACTCATTACATATGATGCCTACCCTAAGTTTATAGAATCTGCCAAAATTATGGATCCGGATGAGCAATTGGAAACCCTTCATGAAGCACTGAAACTACTGCCACCTGCTCACTGCGAAACCCTCCGGTACCTCAT
Ensembl | human accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... CHN1(1123)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Related Content
Instructions
Chunfeng Pan et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 43(1), 339-352 (2017-08-31)
Recently, long non-coding RNAs (lncRNAs) have been found to have many biological effects in different cancer stages. Several studies have revealed that focally amplified lncRNA on chromosome 1 (FAL1) regulates cancer progression via p21. However, the expression and mechanism of
Zhuomin Wu et al.
Molecular neurobiology, 54(10), 7670-7685 (2016-11-16)
In recent years, long noncoding RNAs (lncRNAs) have been shown to have critical roles in a broad range of cell biological processes. However, the activities of lncRNAs during ischemic stroke remain largely unknown. In this study, we carried out a
Danni Wang et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 40(3-4), 644-656 (2016-11-30)
Microarray screening had found BRAF-activated non-coding RNA (BANCR) was significantly upregulated in type 1 endometrial cancer (EC). This study aimed to assess the potential role of long non-coding RNA (lncRNA) BANCR in the pathogenesis and progression of type 1 EC.
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU016511-50UG | 04061828339112 |
| EHU016511-20UG | 04061828574537 |