Skip to Content
Merck
CN

EHU016631

Sigma-Aldrich

MISSION® esiRNA

targeting human TXNIP

Sign Into View Organizational & Contract Pricing

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCCACACTTACCTTGCCAATGGCCAGACCAAGGTGCTGACTCAGAAGTTGTCATCAGTCAGAGGCAATCATATTATCTCAGGGACATGCGCATCATGGCGTGGCAAGAGCCTTCGGGTTCAGAAGATCAGGCCTTCTATCCTGGGCTGCAACATCCTTCGAGTTGAATATTCCTTACTGATCTATGTTAGCGTTCCTGGATCCAAGAAGGTCATCCTTGACCTGCCCCTGGTAATTGGCAGCAGATCAGGTCTAAGCAGCAGAACATCCAGCATGGCCAGCCGAACCAGCTCTGAGATGAGTTGGGTAGATCTGAACATCCCTGATACCCCAGAAGCTCCTCCCTGCTATATGGATGTCATTCCTGAAGATCACCGATTGGAGAGCCCAACCACTCCTCTGCTAGATGACATGGATGGCTCTCAAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Tina Oberacker et al.
FEBS letters, 592(13), 2297-2307 (2018-06-14)
The "free radical theory of aging" suggests that reactive oxygen species (ROS) are responsible for age-related loss of cellular functions and, therefore, represent the main cause of aging. Redox regulation by thioredoxin-1 (TRX) plays a crucial role in responses to
Jianjun Jiang et al.
Lipids in health and disease, 20(1), 19-19 (2021-02-23)
This study aimed to explore the effects of ceramide (Cer) on NLRP3 inflammasome activation and their underlying mechanisms. Lipopolysaccharide (LPS)/adenosine triphosphate (ATP)-induced NLRP3 inflammasome activation in J774A.1 cells and THP-1 macrophages was used as an in vitro model of inflammation.
Takhellambam S Devi et al.
Biology open, 8(4) (2019-04-27)
Thioredoxin-interacting protein (TXNIP) plays a critical role in oxidative stress, inflammation, apoptosis and the pathogenesis of diabetic retinopathy (DR). However, the role of TXNIP in high glucose-induced retinal pigment epithelium (RPE) dysfunction is still unknown. Here, we show that high
Je-Oh Lim et al.
Cells, 9(3) (2020-03-14)
Silica dioxide nanoparticles (SiONPs) have been applied to several fields, such as drug delivery and gene therapy. However, SiONPs are a constituent of fine dust and can induce excessive inflammatory responses in the lungs via the airways. Silibinin, a major
Yu Tian et al.
Neurochemical research, 45(2), 428-436 (2019-12-21)
Ischemic stroke is a life-threatening cerebrovascular thrombotic disease, oxidative stress is considered to be a critical factor to stroke pathophysiology. This study aimed to investigate the underlying molecular mechanism and propose the potential therapeutic strategy for ischemic stroke. Bioinformatics analysis

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service