Skip to Content
Merck
CN

EHU016751

MISSION® esiRNA

targeting human CTGF

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

Product Name

MISSION® esiRNA, targeting human CTGF

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGCACCAGCATGAAGACATACCGAGCTAAATTCTGTGGAGTATGTACCGACGGCCGATGCTGCACCCCCCACAGAACCACCACCCTGCCGGTGGAGTTCAAGTGCCCTGACGGCGAGGTCATGAAGAAGAACATGATGTTCATCAAGACCTGTGCCTGCCATTACAACTGTCCCGGAGACAATGACATCTTTGAATCGCTGTACTACAGGAAGATGTACGGAGACATGGCATGAAGCCAGAGAGTGAGAGACATTAACTCATTAGACTGGAACTTGAACTGATTCACATCTCATTTTTCCGTAAAAATGATTTCAGTAGCACAAGTTATTTAAATCTGTTTTTCTAACTGGGGGAAAAGATTCCCACCCAATTCAAAACATTGTGCCATGTCAAACAAATAGTCTATCAACCCCAGACACTGGTTTGAAGAATGTTAAGACTTGACAGTGGAACTACATTAGTACACAGCACCAGAATGTATATTAAGGTGTGGCTTTAGGAGCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Zhi-Wen Huang et al.
DNA and cell biology, 36(9), 759-766 (2017-07-29)
Cardiac fibrosis is closely related to multiple cardiovascular system diseases, and noncoding RNAs (ncRNAs), including long noncoding RNA (lncRNA) and microRNA (miRNA), have been reported to play a vital role in fibrogenesis. The present study aims to investigate the potential
Rohan Samarakoon et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 30(10), 3308-3320 (2016-06-23)
Protein phosphatase magnesium-dependent-1A (PPM1A) dephosphorylates SMAD2/3, which suppresses TGF-β signaling in keratinocytes and during Xenopus development; however, potential involvement of PPM1A in chronic kidney disease is unknown. PPM1A expression was dramatically decreased in the tubulointerstitium in obstructive and aristolochic acid
Huijun Zeng et al.
Cell death & disease, 8(6), e2885-e2885 (2017-06-16)
Limited benefits and clinical utility of temozolomide (TMZ) for glioblastoma (GB) are frequently compromised by the development of acquired drug resistance. Overcoming TMZ resistance and uncovering the underlying mechanisms are challenges faced during GB chemotherapy. In this study, we reported
Erika Gucciardo et al.
International journal of molecular sciences, 19(12) (2018-12-16)
Diabetic retinopathy (DR) is the most common diabetic microvascular complication and major cause of blindness in working-age adults. According to the level of microvascular degeneration and ischemic damage, DR is classified into non-proliferative DR (NPDR), and end-stage, proliferative DR (PDR).
Kai Yang et al.
OncoTargets and therapy, 9, 7285-7295 (2016-12-13)
Colorectal cancer (CRC) is one of the most commonly diagnosed cancers among both males and females; the chemotherapy drug 5-fluorouracil (5-FU) is one of a doctors' first lines of defense against CRC. However, therapeutic failures are common because of the

Related Content

Instructions

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service