Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TCCCTGGAACCAAGTATTGCTTTGAAATAGTTCCAAAAGGACCAAATGGGACTGAAGGGGCATCTCGGACAGTTTGCAATAGAACTGTTCCCAGTGCAGTGTTTGACATCCACGTGGTCTACGTCACCACCACGGAGATGTGGCTGGACTGGAAGAGCCCTGACGGTGCTTCCGAGTATGTCTACCATTTAGTCATAGAGTCCAAGCATGGCTCTAACCACACAAGCACGTATGACAAAGCGATTACTCTCCAGGGCCTGATTCCGGGCACCTTATATAACATCACCATCTCTCCAGAAGTGGACCACGTCTGGGGGGACCCCAACTCCACTGCACAGTACACACGGCCCAGCAATGTGTCCAACATTGATGTAAGTACCAACACCACAGCAGCAACTTTAAGTTGGCAGAACTTTGATGACGCCT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... PTPRJ(5795)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Related Content
Instructions
Yiting Sun et al.
Journal of Cancer, 11(9), 2667-2678 (2020-03-24)
CD148 is a member of the receptor-type protein tyrosine phosphatase family encoded by the PTPRJ gene and has controversial impacts on cancers. In this study, we investigated the clinical significance of CD148 in gastric cancer and the possible mechanisms. Suppressed
Gregory C Sartor et al.
The Journal of neuroscience : the official journal of the Society for Neuroscience, 35(45), 15062-15072 (2015-11-13)
Epigenetic processes that regulate histone acetylation play an essential role in behavioral and molecular responses to cocaine. To date, however, only a small fraction of the mechanisms involved in the addiction-associated acetylome have been investigated. Members of the bromodomain and
K Spring et al.
Oncogene, 34(44), 5536-5547 (2015-03-17)
DEP-1/PTPRJ is a receptor-like protein tyrosine phosphatase mainly known for its antiproliferative and tumor-suppressive functions. Many identified substrates are growth factor receptors, and DEP-1 is deleted and/or mutated in human cancers including that of the breast. However, DEP-1 was also
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU016811-50UG | 04061828339396 |
| EHU016811-20UG | 04061828574650 |