Skip to Content
Merck
CN

EHU017941

MISSION® esiRNA

targeting human FPR2

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

product line

MISSION®

description

Powered by Eupheria Biotech

form

lyophilized powder

esiRNA cDNA target sequence

CTTTTGGCTGGTTCCTGTGTAAGTTAATTCACATCGTGGTGGACATCAACCTCTTTGGAAGTGTCTTCTTGATTGGTTTCATTGCACTGGACCGCTGCATTTGTGTCCTGCATCCAGTCTGGGCCCAGAACCACCGCACTGTGAGTCTGGCCATGAAGGTGATCGTCGGACCTTGGATTCTTGCTCTAGTCCTTACCTTGCCAGTTTTCCTCTTTTTGACTACAGTAACTATTCCAAATGGGGACACATACTGTACTTTCAACTTTGCATCCTGGGGTGGCACCCCTGAGGAGAGGCTGAAGGTGGCCATTACCATGCTGACAGCCAGAGGGATTATCCGGTTTGTCATTGGCTTTAGCTTGCCGATGTCCATTGTTGCCATCTGCTATGGGCTCATTGCAGCCAAGATCCACAAAAAGGGCATGATTAAATCCAGCCGTCCCTTACGGGTCCTCACTGCTGTGGTGGCTTCTTTCTTCATCTGTTGGTTTCCCTTTCAACTGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

常规特殊物品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Liang Zong et al.
Journal of experimental & clinical cancer research : CR, 36(1), 181-181 (2017-12-13)
Pancreatic cancer is a lethal disease in part because of its potential for aggressive invasion and metastasis. Lipoxin A4 (LXA4) is one of the metabolites that is derived from arachidonic acid and that is catalyzed by 15-lipoxygenase (15-LOX), and it
Yi Xiang et al.
American journal of cancer research, 6(11), 2599-2610 (2016-12-03)
The G-protein coupled chemoattractant receptor formylpeptide receptor-2 (FPR2 in human, Fpr2 in mice) is expressed by mouse colon epithelial cells and plays a critical role in mediating mucosal homeostasis and inflammatory responses. However, the biological role of FPR2 in human
Maayan Pereg et al.
PloS one, 14(6), e0217681-e0217681 (2019-06-07)
The ability to efficiently perform actions immediately following instructions and without prior practice has previously been termed Rapid Instructed Task Learning (RITL). In addition, it was found that instructions are so powerful that they can produce automatic effects, reflected in
Shixun Wang et al.
BioMed research international, 2016, 4819327-4819327 (2016-03-24)
Visfatin has been reported to exert an important role in the development of atherosclerosis. However, the mechanism that regulated the expression of Visfatin has not been elucidated yet. This study aimed to investigate the effect of SAA on the regulation
Padma Murthi et al.
Cells, 9(4) (2020-04-16)
We reported earlier that an anti-inflammatory small peptide receptor-formyl peptide receptor-2 (FPR2) was significantly decreased in placentas from third trimester pregnancies complicated with fetal growth restriction (FGR), compared to placentas from uncomplicated control pregnancies, suggesting FPR2 may play a role

Related Content

Instructions

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service