Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
ACTGCAGAAATGAGGCTGGTTTATCTGCTGATCCGTATGTTTACAACTGGACAGCATGGTCAGAGGACAGTGACGGGGAAAATGGCACCGGCCAAAGCCATCATAACGTCTTCCCTGATGGGAAACCTTTTCCTCACCACCCCGGATGGAGAAGATGGAATTTCATCTACGTCTTCCACACACTTGGTCAGTATTTCCAGAAATTGGGACGATGTTCAGTGAGAGTTTCTGTGAACACAGCCAATGTGACACTTGGGCCTCAACTCATGGAAGTGACTGTCTACAGAAGACATGGACGGGCATATGTTCCCATCGCACAAGTGAAAGATGTGTACGTGGTAACAGATCAGATTCCTGTGTTTGTGACTATGTTCCAGAAGAACGATCGAAATTCATCCGACGAAACCTTCCTCAAAGATCTCCCC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... GPNMB(10457)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Related Content
Instructions
Rui Jin et al.
Oncology reports, 39(6), 3034-3040 (2018-04-06)
Glycoprotein non‑metastatic melanoma protein B (GPNMB) is a glycoprotein that is highly expressed in various types of cancer, including osteosarcoma. However, its cellular functions and related mechanisms in osteosarcoma remain unclear. In the present study, a higher GPNMB mRNA level was
Feifei Ren et al.
Journal of cellular physiology, 235(3), 2738-2752 (2019-09-10)
Gastric cancer has the fifth highest incidence of disease and is the third leading cause of cancer-associated mortality in the world. The etiology of gastric cancer is complex and needs to be fully elucidated. Thus, it is necessary to explore
Basilio Smuczek et al.
Experimental cell research, 358(2), 323-334 (2017-07-10)
Breast cancer is an important public health problem, and its progression may be related to the extracellular matrix (ECM), which acts as a structural scaffold and instruction source for neoplastic cells. Laminins are ECM proteins regulating tumor biology. The laminin-derived
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU017981-50UG | 04061828330218 |
| EHU017981-20UG | 04061831339918 |