Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TTGCAACAAGAAGCATCCAGGTTGATGGAAAAACAATAAAGGCACAGATATGGGACACAGCAGGGCAAGAGCGATATCGAGCTATAACATCAGCATATTATCGTGGAGCTGTAGGTGCCTTATTGGTTTATGACATTGCTAAACATCTCACATATGAAAATGTAGAGCGATGGCTGAAAGAACTGAGAGATCATGCTGATAGTAACATTGTTATCATGCTTGTGGGCAATAAGAGTGATCTACGTCATCTCAGGGCAGTTCCTACAGATGAAGCAAGAGCTTTTGCAGAAAAGAATGGTTTGTCATTCATTGAAACTTCGGCCCTAGACTCTACAAATGTAGAAGCTGCTTTTCAGACAATTTTAACAGAGATTTACCGCATTGTTTCTCAGAAGCAAATGTCAGACAGACGCGAAAATGACATG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... RAB11A(8766)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Related Content
Instructions
RAB11A mediates the proliferation and motility of esophageal cancer cells via WNT signaling pathway.
Danyi Zhao et al.
Acta biochimica Polonica, 67(4), 531-538 (2020-12-17)
Esophageal cancer (EC) recently has become a common malignancy of digestive system worldwide. RAB11A is a critical member of the small GTPases superfamily and was reported to affect a variety of cellular functions. However, its potential effects on EC progression
Yunxia Zhang et al.
Cancer cell international, 20(1), 571-571 (2020-12-10)
Prostate cancer (PC) is common male cancer with high mortality worldwide. Emerging evidence demonstrated that long noncoding RNAs (lncRNAs) play critical roles in various type of cancers including PC by serving as competing endogenous RNAs (ceRNAs) to modulate microRNAs (miRNAs).
Li Zhong et al.
Signal transduction and targeted therapy, 6(1), 59-59 (2021-02-12)
It remains unknown for decades how some of the therapeutic fusion proteins positive in a small percentage of cancer cells account for patient outcome. Here, we report that osteosarcoma Rab22a-NeoF1 fusion protein, together with its binding partner PYK2, is sorted
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU018981-50UG | 04061828331178 |
| EHU018981-20UG | 04061831340075 |