Skip to Content
Merck
CN

EHU019941

MISSION® esiRNA

targeting human HIPK3

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

Product Name

MISSION® esiRNA, targeting human HIPK3

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGGGAAAGATGTCGAGGAAGTAAGTTGTATAGAAACACAGGACAATCAGAACTCAGAAGGAGAGGCAAGAAATTGCTGTGAAACATCTATCAGACAGGACTCTGATTCATCAGTTTCAGACAAACAGCGGCAAACCATCATTATTGCCGACTCCCCGAGTCCTGCAGTGAGTGTCATCACTATCAGCAGTGACACTGATGAGGAAGAGACTTCCCAGAGACATTCACTCAGAGAATGTAAAGGTAGTCTAGATTGTGAAGCTTGCCAGAGCACTTTGAATATTGATCGGATGTGTTCATTAAGTAGTCCTGATAGTACTCTGAGTACCAGCTCCTCAGGGCAGTCCAGCCCATCCCCCTGCAAGAGACCGAATAGTATGTCAGATGAAGAGCAAGAAAGTAGTTGTGATACGGTGGATGGCTCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Junling Lin et al.
Life sciences, 255, 117835-117835 (2020-05-26)
Emerging findings demonstrate the critical roles of noncoding RNA (ncRNA) in asthma development. Nevertheless, the biological roles of circular RNA (circRNA) in airway remodeling are still elusive. Here, the present research focuses on the regulation of circRNA circHIPK3 in airway
Zhongyue Huang et al.
BioMed research international, 2020, 2727060-2727060 (2020-08-11)
Recent studies have suggested that circular RNAs play an important role in the progression of various cancers. However, few studies have revealed the great value of circRNAs in the diagnosis and prognosis prediction of osteosarcoma (OS). In this study, we
Jia Liu et al.
Genes, 11(3) (2020-04-05)
The highly expressed circHIPK3 is a circular RNA that has been previously reported to regulate the growth of human cells. In this study, we found an increased expression of circHIPK3 in bovine mammary epithelial cells treated with prolactin (PRL) in
X Q Feng et al.
Neoplasma, 67(1), 171-177 (2019-07-17)
Increasing evidence demonstrate that circular RNAs (circRNAs) play critical role in regulation of gene expression, which participate in the pathogenesis of cancer, including chronic myeloid leukemia (CML). In this study, we aimed to investigate the expression profiling of circHIPK3 in
Song Fan et al.
Cancer letters, 362(2), 183-191 (2015-04-07)
Mitochondria play an important role in the initiation of apoptosis. However, whether cisplatin can induce apoptosis by initiating a mitochondrial fission pathway and the mechanism underlying this effect remain poorly understood. In this study, we show that the mitochondrial fission

Related Content

Instructions

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service