Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TGCTTGTGTGGAGAAACAGCTATTAGGAGAACATTTAACAGCAATTCTGCAGAAAGGGCTCGACCACTTACTGGATGAGAACAGAGTGCCGGACCTCGCACAGATGTACCAGCTGTTCAGCCGGGTGAGGGGCGGGCAGCAGGCGCTGCTGCAGCACTGGAGCGAGTACATCAAGACTTTTGGAACAGCGATCGTAATCAATCCTGAGAAAGACAAAGACATGGTCCAAGACCTGTTGGACTTCAAGGACAAGGTGGACCACGTGATCGAGGTCTGCTTCCAGAAGAATGAGCGGTTCGTCAACCTGATGAAGGAGTCCTTTGAGACGTTCATCAACAAGAGACCCAACAAGCCTGCAGAACTGATCGCAAAGCATGTGGATTCAAAGTTAAGAGCAGGCAACAAAGAAGCCACAGACGAGGA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... CUL4A(8451)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Related Content
Instructions
Hiroshi Nakade et al.
International journal of clinical oncology, 25(3), 446-455 (2019-09-20)
Cullin4A (CUL4A), which is a component of E3 ubiquitin ligase, is implicated in many cellular events. Although the altered expression of CUL4A has been reported in several human cancers, the role of CUL4A in esophageal cancer remains unknown. We investigated
Yidan Ren et al.
Respiratory research, 20(1), 84-84 (2019-05-08)
Chronic obstructive pulmonary disease (COPD) is a common respiratory disease with high morbidity and mortality. The most important pathophysiological change of COPD is airway obstruction. Airway obstruction can cause airflow restriction and obstructive ventilation dysfunction. Currently, many studies have shown
B Englinger et al.
British journal of cancer, 116(4), 489-500 (2017-01-18)
Colorectal carcinoma (CRC) is the third most common cancer worldwide. Platinum-based anticancer compounds still constitute one mainstay of systemic CRC treatment despite limitations due to adverse effects and resistance development. Trabectedin has shown promising antitumor effects in CRC, however, again
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU020361-20UG | 04061831340273 |
| EHU020361-50UG | 04061831371109 |