Skip to Content
Merck
CN

EHU020941

MISSION® esiRNA

targeting human PIK3C2A

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCCAAATAGGAGGAGCTGTGAAATTATCCATCTCTTACCGAAATGGTACTCTTTTCATCATGGTGATGCATATCAAAGATCTTGTTACTGAAGATGGAGCTGACCCAAATCCATATGTCAAAACATACCTACTTCCAGATAACCACAAAACATCCAAACGTAAAACCAAAATTTCACGAAAAACGAGGAATCCGACATTCAATGAAATGCTTGTATACAGTGGATATAGCAAAGAAACCCTAAGACAGCGAGAACTTCAACTAAGTGTACTCAGTGCAGAATCTCTGCGGGAGAATTTTTTCTTGGGTGGAGTAACCCTGCCTTTGAAAGATTTCAACTTGAGCAAAGAGACGGTTAAATGGTATCAGCTGACTGCGGCAACATACTTGTAAACTAGTGAATGTTTGAGCTTTGGAAGCATGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jun Lu et al.
Molecular therapy : the journal of the American Society of Gene Therapy, 25(12), 2676-2688 (2017-09-19)
Emerging evidence suggests that dysregulated microRNAs (miRNAs) play a pivotal role in osteoarthritis (OA), but the role of specific miRNAs remains unclear. Accordingly, we identified OA-associated miRNAs and functional validation of results. Here, we demonstrate that miR-218-5p is significantly upregulated
Nathan M Merrill et al.
PloS one, 12(9), e0184909-e0184909 (2017-09-15)
Phosphoinositide 3-kinase (PI3K) family members are involved in diverse cellular fates including cell growth, proliferation, and survival. While many molecular details are known about the Class I and III PI3Ks, less is known about the Class II PI3Ks. To explore

Related Content

Instructions

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service