Skip to Content
Merck
CN

EHU021061

MISSION® esiRNA

targeting human SOX9

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATCAAGACGGAGCAGCTGAGCCCCAGCCACTACAGCGAGCAGCAGCAGCACTCGCCCCAACAGATCGCCTACAGCCCCTTCAACCTCCCACACTACAGCCCCTCCTACCCGCCCATCACCCGCTCACAGTACGACTACACCGACCACCAGAACTCCAGCTCCTACTACAGCCACGCGGCAGGCCAGGGCACCGGCCTCTACTCCACCTTCACCTACATGAACCCCGCTCAGCGCCCCATGTACACCCCCATCGCCGACACCTCTGGGGTCCCTTCCATCCCGCAGACCCACAGCCCCCAGCACTGGGAACAACCCGTCTACACACAGCTCACTCGACCTTGAGGAGGCCTCCCACGAAGGGCGAAGATGGCCGAGATGATCCTAAAAATAACCGAAGAAAGAGAGGACCAACCAGAATTCCCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Corinne Prévostel et al.
Oncotarget, 7(50), 82228-82243 (2016-07-19)
SOX9 inactivation is frequent in colorectal cancer (CRC) due to SOX9 gene mutations and/or to ectopic expression of MiniSOX9, a dominant negative inhibitor of SOX9. In the present study, we report a heterozygous L142P inactivating mutation of SOX9 in the
Xiuyu Wang et al.
Biochemical and biophysical research communications, 516(1), 236-244 (2019-06-22)
The malignant proliferation is one of the major characteristic for tumor cells, however the mechanism of lung cancer cells uncontrollable proliferation is still confusing. This study investigated the mechanism of up-regulated FOXA1 in lung cancer and its tumorigenic function in
C-Q Liu et al.
European review for medical and pharmacological sciences, 23(13), 5628-5639 (2019-07-13)
The aim of the current study was to investigate the potential roles of miR-215-3p in the progression of cervical cancer. The levels of miR-215-3p in both cervical cancer tissues and cell lines were detected using quantitative Real-time polymerase chain reaction
J-C Shang et al.
European review for medical and pharmacological sciences, 23(14), 6160-6169 (2019-08-01)
Gastric cancer is one of the most common gastrointestinal malignancy, which is often diagnosed at an advanced stage. MicroRNA-105 (miR-105) was downregulated and acts as a tumor suppressor in various cancers. The purpose of this study was to explore the
Georg Richtig et al.
PloS one, 12(11), e0187814-e0187814 (2017-11-10)
SOX9 has been previously shown to be involved in hepatocellular carcinoma (HCC) and other types of cancer. However, prognostic studies so far involved rather small cohorts or lack external validation and experimental data. In this study, we firstly determined the

Related Content

Instructions

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service