Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CCCCAGTCACCTGCTGTTATAACTTCACCAATAGGAAGATCTCAGTGCAGAGGCTCGCGAGCTATAGAAGAATCACCAGCAGCAAGTGTCCCAAAGAAGCTGTGATCTTCAAGACCATTGTGGCCAAGGAGATCTGTGCTGACCCCAAGCAGAAGTGGGTTCAGGATTCCATGGACCACCTGGACAAGCAAACCCAAACTCCGAAGACTTGAACACTCACTCCACAACCCAAGAATCTGCAGCTAACTTATTTTCCCCTAGCTTTCCCCAGACACCCTGTTTTATTTTATTATAATGAATTTTGTTTGTTGATGTGAAACATTATGCCTTAAGTAATGTTAATTCTTATTTAAGTTATTGATGTTTTAAGTTTATCTTTCATGGTACTAGTGTTTTTTAGATACAGAGACTTGGGGAAATTGC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... CCL2(6347)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Related Content
Instructions
Jung Hwa Ko et al.
Biochemical and biophysical research communications, 494(1-2), 6-12 (2017-10-24)
The cells of the innate immune system, in addition to their capacity to elicit immunity, play a substantial role in immune tolerance induction. Our group has recently shown that a distinct subset of MHC II
Pranabananda Dutta et al.
Breast cancer research and treatment, 170(3), 477-486 (2018-03-30)
Triple-negative breast cancer (TNBC) is the most aggressive type of breast cancer that lacks ER/PR and HER2 receptors. Hence, there is urgency in developing new or novel therapeutic strategies for treatment of TNBC. Our study shows that the Monocyte Chemoattractant
Chuan Zhou et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 34(1), 1637-1651 (2020-01-10)
Studies on the effects of transcriptional memory on clone reprogramming in mammals are limited. In the present study, we observed higher levels of active histone H3 lysine 4 trimethylation (H3K4me3 and 5-hydroxymethylcytosine) and repressive (5-methylcytosine) epigenetic modifications in bovine early
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU021511-50UG | 04061828332816 |
| EHU021511-20UG | 04061831340402 |