Skip to Content
Merck
CN

EHU021511

MISSION® esiRNA

targeting human CCL2

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCCCAGTCACCTGCTGTTATAACTTCACCAATAGGAAGATCTCAGTGCAGAGGCTCGCGAGCTATAGAAGAATCACCAGCAGCAAGTGTCCCAAAGAAGCTGTGATCTTCAAGACCATTGTGGCCAAGGAGATCTGTGCTGACCCCAAGCAGAAGTGGGTTCAGGATTCCATGGACCACCTGGACAAGCAAACCCAAACTCCGAAGACTTGAACACTCACTCCACAACCCAAGAATCTGCAGCTAACTTATTTTCCCCTAGCTTTCCCCAGACACCCTGTTTTATTTTATTATAATGAATTTTGTTTGTTGATGTGAAACATTATGCCTTAAGTAATGTTAATTCTTATTTAAGTTATTGATGTTTTAAGTTTATCTTTCATGGTACTAGTGTTTTTTAGATACAGAGACTTGGGGAAATTGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jung Hwa Ko et al.
Biochemical and biophysical research communications, 494(1-2), 6-12 (2017-10-24)
The cells of the innate immune system, in addition to their capacity to elicit immunity, play a substantial role in immune tolerance induction. Our group has recently shown that a distinct subset of MHC II
Pranabananda Dutta et al.
Breast cancer research and treatment, 170(3), 477-486 (2018-03-30)
Triple-negative breast cancer (TNBC) is the most aggressive type of breast cancer that lacks ER/PR and HER2 receptors. Hence, there is urgency in developing new or novel therapeutic strategies for treatment of TNBC. Our study shows that the Monocyte Chemoattractant
Chuan Zhou et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 34(1), 1637-1651 (2020-01-10)
Studies on the effects of transcriptional memory on clone reprogramming in mammals are limited. In the present study, we observed higher levels of active histone H3 lysine 4 trimethylation (H3K4me3 and 5-hydroxymethylcytosine) and repressive (5-methylcytosine) epigenetic modifications in bovine early
Xiaomin Huang et al.
Journal of reproductive immunology, 137, 102856-102856 (2019-12-07)
Human chorionic gonadotropin (hCG) can attract regulatory T cells (Tregs) into the fetal-maternal interface regulating maternal immune tolerance in pregnancy. The objective of this study was to investigate whether hCG recruits the Tregs into endometrium by inducing chemokines. The number
Bin Lu et al.
Molecular medicine reports, 16(3), 3387-3394 (2017-07-18)
Glioma is one of the most common types of tumor of the central nervous system. Increased expression of C‑C motif chemokine 2 (CCL2) has previously been observed in various types of cancer. The effect of CCL2 small interfering (si)RNA on

Related Content

Instructions

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service