Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CTGTGGCACAATCGGACTTATTCACGCAGTGGCCAATAATCAAGACAAACTGGGATTTGAGGATGGATCAGTTCTGAAACAGTTTCTTTCTGAAACAGAGAAAATGTCCCCTGAAGACAGAGCAAAATGCTTTGAAAAGAATGAGGCCATACAGGCAGCCCATGATGCCGTGGCACAGGAAGGCCAATGTCGGGTAGATGACAAGGTGAATTTCCATTTTATTCTGTTTAACAACGTGGATGGCCACCTCTATGAACTTGATGGACGAATGCCTTTTCCGGTGAACCATGGCGCCAGTTCAGAGGACACCCTGCTGAAGGACGCTGCCAAGGTCTGCAGAGAATTCACCGAGCGTGAGCAAGGAGAAGTCCGCTTCTCTGCCGTGGCTCTCTGCAAGGCAGCCTAATGCTCTGTGGGAGGGAC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... UCHL1(7345)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Wenjuan Wang et al.
Molecular carcinogenesis, 55(9), 1329-1342 (2015-08-22)
Multidrug resistant (MDR) cancer cells overexpressing P-glycoprotein (P-gp) exhibit enhanced invasive/metastatic ability as compared with the sensitive cells. We aimed to clarify the mechanism underlying this observation and found that during the development of drug resistance to adriamycin in MCF7
Yuyin Xu et al.
Experimental cell research, 382(2), 111463-111463 (2019-06-28)
Diabetic nephrology (DN) is attributed largely to the depletion of podocytes, which is closely associated to apoptosis. However, the complex mechanism of podocyte loss in DN pathogenesis remains unclear. Recently, necroptosis has emerged as an important cell death model in
Yanhong Luo et al.
Journal of cellular biochemistry, 119(1), 691-700 (2017-06-22)
As a de-ubiquitin enzyme, ubiquitin C-terminal hydrolase (UCH)-L1 has been shown to be overexpressed in several human cancers. However, the function of UCH-L1 in invasion of breast cancers is still unclear. Here we report that the expression of UCH-L1 is
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU021911-20UG | 04061828568772 |
| EHU021911-50UG | 04061828333196 |