Skip to Content
Merck
CN

EHU023131

MISSION® esiRNA

targeting human LAMC2

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

Product Name

MISSION® esiRNA, targeting human LAMC2

product line

MISSION®

form

lyophilized powder

description

Powered by Eupheria Biotech

esiRNA cDNA target sequence

TTCAGCTGTCCAGCTTGCTATAATCAAGTGAAGATTCAGATGGATCAGTTTATGCAGCAGCTTCAGAGAATGGAGGCCCTGATTTCAAAGGCTCAGGGTGGTGATGGAGTAGTACCTGATACAGAGCTGGAAGGCAGGATGCAGCAGGCTGAGCAGGCCCTTCAGGACATTCTGAGAGATGCCCAGATTTCAGAAGGTGCTAGCAGATCCCTTGGTCTCCAGTTGGCCAAGGTGAGGAGCCAAGAGAACAGCTACCAGAGCCGCCTGGATGACCTCAAGATGACTGTGGAAAGAGTTCGGGCTCTGGGAAGTCAGTACCAGAACCGAGTTCGGGATACTCACAGGCTCATCACTCAGATGCAGCTGAGCCTGGCAGAAAGTGAAGCTTCCTTGGGAAACACTAACATTCCTGCCTCAGACCACTACGTGGGGCCAAATGGCTTTAAAAGTCTGGCTCAGGAGGCCACAAGATTAGCAGAAAGCCACGTTGAGTCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Qiang-Hua Zhou et al.
Cancer management and research, 10, 2983-2995 (2018-09-15)
Molecular biomarkers, especially serologic factors, have been widely applied in cancer diagnosis and patient follow-up. However, there are few valuable prognostic factors in penile squamous cell carcinoma (PSCC). Here, the authors investigated whether laminin gamma 2 (LAMC2) expression, especially serum
Yao-Fei Pei et al.
The American journal of pathology, 189(8), 1637-1653 (2019-07-28)
Cholangiocarcinoma (CCA) is a malignant cancer that is associated with high mortality rates. The relationship between laminin γ 2 chain gene (LAMC2) and epidermal growth factor receptor (EGFR) has been previously documented in gastric cancer and oral squamous cell carcinoma.
Yan Liang et al.
Cell death and differentiation, 25(11), 1980-1995 (2018-03-08)
Esophageal squamous cell carcinoma (ESCC) is the main subtype of esophageal cancer. Long noncoding RNAs (lncRNAs) are thought to play a critical role in cancer development. Recently, lncRNA CASC9 was shown to be dysregulated in many cancer types, but the
D O Velez et al.
Nature communications, 8(1), 1651-1651 (2017-11-23)
The topographical organization of collagen within the tumor microenvironment has been implicated in modulating cancer cell migration and independently predicts progression to metastasis. Here, we show that collagen matrices with small pores and short fibers, but not Matrigel, trigger a
Manoj Garg et al.
Scientific reports, 7(1), 9749-9749 (2017-08-31)
Anaplastic thyroid carcinoma (ATC) is one of the most lethal malignancies having no effective treatment. Exportin-1 (XPO1) is the key mediator of nuclear export of many tumor suppressor proteins and is overexpressed in human cancers. In this study, we examined

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service