Skip to Content
Merck
CN

EHU024601

MISSION® esiRNA

targeting human MTDH

Sign In to View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCACAGTTACCACCGAGCAACTTACAACCGCATCATTTCCTGTTGGTTCCAAGAAGAATAAAGGTGATTCTCATCTAAATGTTCAAGTTAGCAACTTTAAATCTGGAAAAGGAGATTCTACACTTCAGGTTTCTTCAGGATTGAATGAAAACCTCACTGTCAATGGAGGAGGCTGGAATGAAAAGTCTGTAAAACTCTCCTCACAGATCAGTGCAGGTGAGGAGAAGTGGAACTCCGTTTCACCTGCTTCTGCAGGAAAGAGGAAAACTGAGCCATCTGCCTGGAGTCAAGACACTGGAGATGCTAATACAAATGGAAAAGACTGGGGAAGGAGTTGGAGTGACCGTTCAATATTTTCTGGCATTGGGTCTACTGCTGAGCCAGTTTCTCAGTCTACCACTTCTGATTATCAGTGGGATGTTAGCCGTAATCAACCCTATATCGATGATGAATGGTCTGGGTTAAATGGTCTGTCTTCTGCTGATCCCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Chen Liang et al.
Experimental and therapeutic medicine, 21(1), 22-22 (2020-11-26)
Vasculogenic mimicry (VM) contributes to the resistance of anti-angiogenic therapies in glioma. Certain genes, including MMP-2 and VEGF may be associated with the development of VM. Astrocyte elevated gene-1 (AEG-1) is considered to be an oncogene that promotes autophagy, invasion
Yongfeng Zhang et al.
Molecular medicine reports, 18(3), 3099-3105 (2018-07-18)
MicroRNAs (miRNAs/miRs) serve important roles in regulating gene expression by directly binding to the 3'‑untranslated regions of target genes. Multiple miRNAs are dysregulated in retinoblastoma (RB) and their dysregulation is closely related to RB malignancy. Therefore, exploring the detailed roles
Rongquan He et al.
American journal of translational research, 9(4), 1561-1579 (2017-05-05)
Recent studies found that metadherin (MTDH) played an essential role in hepatocellular carcinoma (HCC). Nevertheless, the exact function of MTDH in the pathogenesis of HCC was unclarified. In the present study, we aimed to investigate the clinical significance of MTDH
Dong Pan et al.
International journal of oncology, 54(6), 1955-1968 (2019-05-14)
Studies have rarely been conducted on the role of miRNAs in prostate cancer (PCa) cell progression by directly targeting MTDH, at least to the best of our knowledge. Thus, the present study aimed to identify miRNAs closely related with metadherin
Fan Yang et al.
OncoTargets and therapy, 12, 4415-4426 (2019-06-27)
Purpose: Several microRNAs (miRNAs) that are aberrantly expressed in glioblastoma multiforme (GBM) play a significant role in GBM formation and progression. The expression profile and functions of miR-559 in GBM remain unclear. Here, we quantified the expression and investigated the

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service